Description :
From Genome Similarity Track
Location :
Scaffold_1650:2- 1714
Sequence
1712 bases(100 bases per row)
AAGCACAATGACGCAAGGTTCAGACCAAATAACGGCATCTCCCCATCGTCATGTGATTCTTGGATAGAACGTGGGTCAAGCACAAACTGAAACGTGTTGA
AGCGTCGGCTGGAGCTGTCTTTCTGTAACGGGGTTACACATCGAAGGGTACTCGGTACCCTGTGTCTTAGACGCACGGGATGGTATCTCACTGAAAGAGA
TATAGAATATCTTATCGGCTTATAGGGGCTGACGGTTGTCAGCCACGAGATAGGAAAGATCTCGAAAGTTCTTGATTTAGGAGATGAGCGCCTAGATTCG
GTAATATTAGCATTAAGATATTCTATAAGAGTTAAACGTAAAAAAAGTTCAGTTCCCCTTTGATCTTTTCTAAGACACGTGCCTTGCGAGGCGTCTCTGA
TAGTTGATCGTTAAGAGTTAGCAACATCTCCCTGCGGTAGCTACTCTTGAGCACTACGTGCTGTAGATTCACTGAATCGTTCGGTCCCCTGGAACAGGGA
CCTTAAGCTTCACGCTTGTTGACTCGTAGAGTCTAGTTCTTTAGAACTAATATCGCTCTTTGAGCACTAAGTCTCCCTCTGACTTAAGGAGCTTTGTAGC
TCCGCTACACTTAAGCACTCGTAGTCAATCTACGCCTGAGACTTTAAAGACTGATCCTCTGTGAGGATGGAAAACCCCACTCCCCTCTCTGAGGCCCAAA
AGGCCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAATATGTGGGATTCCTTGTATCGCAAGGCCCGGAAGTGCTGAGTGCACGTGTTGAGGGCTT
CTTGCAGTATGAAGCGTCCCTTCTAGGACAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACGCTATGTGTCTGTTCCAGACGAAGAGGCTACGCCT
CGTCCACTTAGAGTGGAAGTTAAAAACTAGTCAGGAAAGGAGGGTGAAAACCTCATCCTCTAGATCCATGAGATTTAGATGGCCATCAGATCAGGCCTGA
TCAAGCTTGACCATCAACAGGTATCGCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGGGCCTTGATGTGTAGCACGTCGGTCGACTTAACGTT
TCCCACATGGGAGTCGCTTAAGTAACAATTGGTACAGATGTTTTCGCCACCTAACCAGGCTTACCGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGT
AAGAATGAGCTAACGAACTATGTCCAAGGGTTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAAGCAGTCCATGTGACTATATTCATGG
AGGGTCTCCGTACTAGCGTTGCCAGAACCGAAGTTTTTCGGGTTTACCCCTCTACATTCGAAGAGGCTGTGAGAATTGCTCTTAATGCTGAGCATAACTT
CAAGTCGACCAGACTTGGCTGGAATAGGTACAACCCTAGCTCTGGGAGAGCAAACTACATGAGTACTCCGGCCGTTAACAGGCCGGAACCGATGGATCTC
AGCTATGCTGAAGATGAAGGTGAAGTTGAATTTCAAACTACTGAGCAGCAACGTGCTGTAAGAAGGTGTTATACGTGCGGAAGCACTAAACACTTACGGC
CTGGTTGCCCTTTGCGTAGACAGCACCAGGCTACGAATCAACACTCTACCCCGAGCCAGAAGTCTGGCATGGCACAGGTAAATGCCGACACCCCGTAGGC
GCGGGGCGCCCT