Description :
From Genome Similarity Track
Location :
Scaffold_3031:2- 1692
Sequence
1690 bases(100 bases per row)
TCCACGTCTTGTTGTGATCTATTGGCTTCTCCACTTCGGATACTAGAATCACGCAGGCCCAAGAATCTCATTCTTCGCTGATGGTCTTTCAGTGGTGTGC
GCTCGACGGTATGTTTCGATTTTTATCGGATGGTACCCTCTTTTTTACCCTTGACGAGATGCTGATTCCAGCTCCAGCCGCCGCCTATCGTTATATGAGG
CGAAGATTGAGAATCATAAGGGTCGGATTCGACTACCTGGATTGAGGCTCTGGGGAAACCTGGGAGCTCCCAGTCCCGGTTAAAGTGGGTGGAACCATGA
GAAACAGTGTGGTCACTCGGGGCGAGATATGGGGTACCTTCCGTAATCCTAGGCGCCAGGTCGATCACAATACCTCCATGTCACGAACGTCAGCGATAAG
AGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACA
AAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCGCGGCGAAGCCAACTGGCCCCTTGGTGGATCGGTC
TTCATATCCAACTCCGCGAAAGATCCTGATGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGG
CCCTTAGATAACGCAGGGTCAGTGGATGAAGGATTGCAGAGGGTTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGG
ATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGACGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTT
CCCTGATACCAGGGTACCTGATTCTCCGAAGACAGAAGGACTACCAGGTGAAAGAGGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAGACGGAA
GATGAACAAGTCTGTTTCCATGAAGGCGGGGATCTACACGCCAAGGATCTCGGGGATGGCCTGGCGGTAATCCCGGAGGTACCACTGACCACAGAGGAGG
TCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCGACATCTGCTGATTGGT
AAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGTACCTC
AGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCAT
CAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTTGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTG
TTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGTCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCAT
TCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAATGCACCCCAGATCTACCAACGTCTAATCGATAACG