Description :
From Genome Similarity Track
Location :
Scaffold_3147:2- 1688
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3147-snap-gene-0.1Cleavage induced predicted protein

Sequence
1686 bases(100 bases per row)
CTTCTCCATGTTCACGGACGACGCCAAGTTCTGGTGGATAAGCGAAGGCAACGTTAGCCTCCAGAACTTCGCGCCACACGTGGCCGCACCGAAGCCAGCG
GCGCCACTGCAGTTCAGAGTCATCACCGAGGCGACCCGCGTGTTGGCACGCTTTGGCATCGAGTACTTCAACAGTGACGTTAACAACATGATCGCAGAAG
CAGTCAGCCTGCTCCACGTACTCGCCAATTTGTACGACTGGTCACGCGACGATCGACTCCACATTGACTACTTCGTGAACGCGACGTTCGAGTCGTTCCG
AGCGTCACTCGAGTCAACTGAACTCGACTGCCACCAAGTCGCCACCAAGATGCAGAGCAAGGTTATGACAGAAGATGTCGCCGTCCAACCTCTTCTACTC
GCAGCGCAAGTCCCTCACACCAGATGCTTTGAATCGATGAGCGCGGTGTGATCATTTGACAGCTCACCGCTGCTCAAGTATGAGGACAACCAGTCATCCA
GACGAAACAAGCTCGTGAAAGAACTTATAGCTTTCATCCCGCGCCACAATGGGCAACCAATTTGACTGAAGAACCTGTCGCGCGAAGGGTGCGGCATGGC
CGCATGCAGACGTCCAAACGTTGTCCCAGCGTCACTCGAACTGAAATTGAAGGCTTACGTGGTGCAGCGATGAGCGGACCTATGCAGTGCAAGCGAGCGA
CTGTGAAGACAGCCAAGGCAGCCGTTTTACTTCATCCCGTCGATCGAGATGGTACGTAACCCGATCCAGCTGCCATCAACTATGTGTGCCGCACCCACAC
TAGTTCAGCGCCTCCAGTCACCACCTGTAGCTGGATGCCACACGGAAGAATGTCGGACATTCCACACCAATAGGGGTCAACTCAAGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTGCAGAGGCGGCACCCGAAGCTGGAACCACCCGCCACGCATGCGCTG
TTCCAAAGAGTCGCGCCCACACATAGTGTGGAATACACGATTTCTTCGTGCTCCGCACTTCCTCAAAATAGACCACTGTGTCGATCACCGTCGACAACGC
AATGAAGCCTATCACTGACATCAGCGGCTGCTACTCAATCTAAACTGAAGCACCGCCTGGTACCAGCTGATCACAGGCACCAGTGCATGCTTCTATCAGT
CATTGGCATCAAGCACGCAGAGTCAAGATCAGCGCCAGTGAATCCATTCTCACTTGATACGCAGTTGACGAACGCAATCTCCCAGTATGTGCGCAGTACT
GACGCAGAGCTGGGCGATGTGGTTCGCTTATCACGACGCGAGACCAAAGCTGATCCACGTCCAAACAAAGCGTTGGATGCAGATCTGTTGGAGTGGCTCC
TTGGCGGCTATGAAAATCGGGATGTTCTTGTCAAAATCGCGTGCCACGGCGTCGTACCCAGCTGGGATCCCGTTGCGATATCGTCGATCCAGCCCCAAAA
GAATCACAAGTCTTCTCAAGTCTACTCACGCGCGTTGGCAAGAAGTCTTCGAGAAGGTCAGGAGAAAGGGCAGTACCTAATCATGA