Description :
From Genome Similarity Track
Location :
Scaffold_4899:2- 1687
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_4899-abinit-gene-0.6Glucose regulated protein /BiP
Pytiw_DAOMBR242034maker-piw_contig_4899-snap-gene-0.2LAC ORF protein

Sequence
1685 bases(100 bases per row)
GAGCCTCGTCGTCCTCGCGCTCTTCACGCTGGTGTTCGCAGGAGCTGCTGCTGCTGCTGCAAGCGACGCCTCGGGTACCTCTCGCGGCCCCATCATCGGC
ATCGACCTCGGCACAACGTACTCGTGTGTGGGCGTGTACAAGGACCAGAAGGTCGAGATCATCGCCAACGACCAGGGCAACCGCATCACGCCGTCCTACG
TGGCGTGGGACTCGAACGACGAGCGTCTCATCGGCGACGGCGCCAAGAACCAGGCGACGATCAATCCGGAGAAGACAATCTTCGACGTCAAGCGCCTCAT
CGGGCGTGACTACAGCGACAAGTCCGTGCAGGCCGACAAGAAGCTCCTGCCGTACCATATTGTGAACAAGGACGGCAAACCCATGATCGAGGTCCTGATC
AAGGGCGAGAAGAAGCTGTTCTCGCCTGAAGAGATTTCTGCGATGATCCTGACCAAGATGAAGCAGATCGCAGAGAGCTACCTCGGCCGCGAGGTCCACG
ACGCGATCGTGACGGTGCCCGCGTATTTCAACGACGCCCAGCGCCAGGCCACCAAGGACGCGGGCACGATCGCTGGCCTCACGGTGCAGCGCATCATCAA
CGAGCCGACGGCGGCTGCAATCGCCTACGGCATCGACAAGCAGAGCGAGGGTGAGAAGCACGTGCTGGTCTTTGATCTGGGCGGCGGTACGTTCGACGTG
ACGCTGCTCGCGATCGAAGGCGGCGTGTTCGAAGTACTGGCGACGAACGGCGATACCCACTTGGGCGGTGAGGACTTTGACCAACGAGTGATGCAGTTTT
TCATCAAGAAGTGGAAGAAGGACAGGGGAATTGACATCGGTTCGGACAAGCGCGCGCTCCAGAAGCTCCGACGCGAAGCTGAGCGTGTGAAGCGCGCACT
GTCGACCCAGACCCAGGCTCGACTCGAGATTGACTCGCTGCTCGATGGTGAAGACTTCAGTGAGACGCTCAGTCGCGCACGCTTTGAGAAGCTCAACGAA
GACTTGTTCAAGAAGACGCTGACGCCCGTGGAGAAAGTGTTGAAGGACGCTGGGATCAAGAAGTCCGAGGTAGACGAGATCGTGCTCGTGGGCGGCTCGA
CACGGATCCCCAAGGTGCAGCAGCTCATCAAGGACTTCTTCAATGGCAAAGAGCCCAGTCGGGGCGTGAACCCGGACGAAGCCGTGGCCTATGGCGCTGC
CGTCCAAGGCGGGATCCTCGGCGGTATGAACCAGAAGGATCTGGGCGACATCGTGCTGATTGACGTGGTGCCACTCTCACAGGGTATCGAGACCGTCGGT
GGTGTGATGACCAAGCTGATCAACCGGAACACGGCGATCCCGAACAAGAAGTCACAGGTGTTCTCGACTCACGTCGACAACCAACCAGCCGTGTCGATCA
AGGTGTACGAAGGTGAGCGCACGTTGGTCAAGGACAACCACTTGCTGGGAAAGTTCGATCTCACGGGCATCCCTCCGGCTCCACGCGGGATCCCGCAAAT
CGAAGTGACGTTTGAGATCGACGCGAACGGCATCCTGCAGGTCTCAGCAGAGGACAAGGGCACGGGCAAAGCCGAGAAGATCACGATCACGGCCGAGAAA
GGACGGCTCTCTCAGGCTGAGATCGATCGCATCATTGAGGAGGCCGAGCAGTTCGCCGAGGAGGACAAGAAGGTCAAAGAGCGCA