Description :
From Genome Similarity Track
Location :
Scaffold_63:2- 1673
Transcript NameFunction/comments
Physo_138382hypothetical protein

Sequence
1671 bases(100 bases per row)
GAAGGCCCGGCAGCAAGCGCGTGACGAGGCGACGAAGCAGGAGATGGAGCGGCAGCTCCACAAGCGACGAAAGCGGCTCGATCACACCAAGGCGCGTCGA
GAGCGGCGTGCTGAGCGTGAACGGATGGCGGCTGGTGCAGACAGAGCTACTGGGGTTCATGCTGGTGAAGAAGCCGATGGTGACAAGGGAGGCGCTGCGC
GACGAAGTGGTGAAGGGCAAGACGAGCACGTGCGCGTCGGAGAAGCTGTCGGTGGTGACGAAGACGCAGAGGGTCGCGACGACCAAGGTGCGGCGGCGGA
TATGCTGCGCGGACGAGGACGAGCACAATGGCAGCCGCCAATGCCGGAGCTCCTGCAAGTGGAGACCGCTGGCTACATTGTTGAACGAGCACGCCGGCGA
GTGCGCAACCGCGCAGGACGCTACGTGCGTGAGCACCAAGTGGAGTACAGCACTGGGCCAGGACGACCAGCGGGACGGCGATGGCTCACGGAAGCAGAGT
TCGAGCAGCTCGAAGATGCTGCCAAGGTCGAGGACGACCTTGGAGCCGGGGATGGCGTGTAGTTGGATGGCCTGTCACGTGACGAAGGGCCACGAACAGG
CAGCGCCAGACGCGCTGGTGATCGACTTGACAGACGAGTAGTGTGGTGGACATCGGCCAGATCGGGTCGTAGTGTACGGCAGGAGGCGTGTGGTGAAGAG
GGCAAGCCAGTGGACTAGTGCCACCGGCTGAAGGCGGTCGTTTAGCAAGCAGTGGAAGTTGGTGATGGCGACGACAGAAGATCGCAGTGTGTGGGCGACA
TGCCGGGACAAGAGCGAAGAAGTATACGAGCGAGGAGAGGCGAGATCAAGGACAGGAACGTGAGGCTGTGAGGCCACGAGCATGGAGAAGGAGTCGAAGA
GGGAGAGGTCCAGTAAGTAGGCAGGCGCCCGTGCGTAGGAGTAGATACAGCGGGGATAGGATTGAGTAGGAGGATACTGAGCGGCGGTCGGCCGACTCGA
CCCTCAGTTGCGGTTTTTCATAGGATTGTGGAGAGTCAAGACTAATATACACGAGTTGCGCCGAACGCACGGGATTCCGGTCTTTGGAGCAGCGACGAAG
AGCGTCGGCCAAAGCGACGGCAATAGCGAAGGTACGGCAGTGGTAGGCCAGTGCACAGATGAGGGCAGTGTTCGAGTAGGGCGGCAGGACTGTGGAGAGA
GACCACGGGGGCTGTGGTGTTGGAGCACCTCGGTCGAGTGGCGCGGAGCTCGCATGTGCCAGTGTGCGAAGGGCTCTTGCTGCCTGCTGTATATAGCCGG
GCTTTACGAGCTGGAAACAGCTAGTGAGGCTACCCGACCACTAGTGCTTATAACGTTTCCTCCTAGCCATCCCTATCCTAGCCATGCGTGCAGGCCAGTA
ACGTCTGGTCGACACTGAACGGCCTCGCACTGGAAGAGACTCTGCTTACCGAGACGCTCCCTAGGTGCTTAGGTGAGCAGCTTGTGTTAACGATCTCCCT
CCGACGCGGTGCAAGAAGAAGGGCACTCGGAGTGGAGATAACGACAACGGTCTAAACCTAGAACGGAGACTTGCAAAAATGGTAGTTACCGACACTTTTG
ATGTGGCCCCGCCACTGCCTGCTACTACCCTGGATCTTGGTAGGTAGTTCCGAGCTTTATCTGGGGAAACC