Description :
From Genome Similarity Track
Location :
Scaffold_3519:2- 1658
Transcript NameFunction/comments
Phyta_totarag15337hypothetical protein

Sequence
1656 bases(100 bases per row)
CAAGGGTAATACTTCTGTACTGAAGCCCAGTACAGGTCTGCGTCAACACATTCAATGTCTCGACGCTCGACGTCGGAACTGATGTCTGCCCGGCAGACAC
CTTGCTTAACGTCTCGGTCCCGGACCGAGACTCGCAcagtttcttcagcttgcgctGTCGCTTCTTCGAGCGGAGCCTGGCTCCGCGTGttcctcgtcca
cgcccGCTTGACCGGGCACTGGATAGGTCCGCGTTGTTGTCCCCGGCGGATTGTATCCGCGGGCACACGTCATCAAGCCCGGCTGCACGAGAGCTCGCAA
GCTCGCAAGCTTTTTCGGTGCTGGACATTTGCAACCGCCCGCACTGCTTGCAGCGTCAGCTCCAGGAGCTgacgcgccttcgtcgcctcgacgccTTTCG
GCGGAGATTTCTGCCGAATCTGATCCAATCAGATTCGCGTCAGCTCCCGGAGCTGACTCGTCGCCGTCACNTCCAGTCCATCTTTCGGTCATGCTGTGCA
AGCCACGgcatgtccagcaccaagtcgaacttgtcgtctaaATCCAAGACGATAAGATCCTCAACAAATTCCTTTTGTTGATACGAGAAGCGTACGCTTA
TGGCACGCTTCTCTGTCTTGACGACGGCACCTGATgccagtcgtacttccaatACACTTCGAGGTGTCTGTACCTCCTCGAAGCCATGGCTTGACAGACT
CTGCTGTCGAACAATGTTGTTCGACGCACCTGAGTCTATCAAGGCACGAAGAGAGTCCGCTCTCTTCGAAgacacgtccacgatgaCAAATTTTGGCTTA
TAATCTCGCCTGTTGCAGTGAGATTGCCTCTCACGGGGGGCTGCAGTCATCATTGACGCGTGTCCAATGTCGGCACGCGTGACTGCTTTACTAGTAGGGC
GCCCCGCGCCTACTGGTTCCGCGCGTTTTTTTATTGATCGTGGCGACGCAGGgcatcgccacgttggcCTCTCTGCCCGTGCAcaggtgctgtgcactca
CGCGCAAAATGACCGATGCGTCCGCAACGGAAGCATCGTACGTCAGATccgcgacgtggtgggtTGCTCCCAGCTGTCGCGTTTGAGAGGTCCATTGGTT
CTGGGCCTCTCGTCCTTACCACCGGACGTGGCATCCTTGGCACCTTCAGATGCAGTTTAGCCTGCCGCAGGCTAAACGCTTCCTGCATTGCGAACGTgat
cgcagcttcgagagtACTCGGGTATTCTCGGAAGACGTAGGTCTTCGCAGGCCCATCCTTCAAGCCCTTCATGAACGTGATGACCTTGGTCGCCTCGTCT
ATCGGGTTGATCACGATGAACAAGACTAGGTACCGTGCCATTTGGGCGTAAACATGGACATCATGCTTgccctgctgcagatcgaggaaCTCAGCNCATA
CGTCGAGCCGTAATGGCTGTGTCGACCTCGACTAGCCAACGGAGAAGAGGCCCGCCCTATTTTCCCACATAGTTGCTCACGTGGAGCTTCAGCGATATCG
ATCGCAGGGTCGTCGGGGGCGACGCCGTCGTAGAAGTAGAAGCATCTAGCTGCTCCTTAAAGATAAAGCCCAGAGCAACACCGGGTTGCTCTGACTGTGA
TAGCGTGCGTAGCATCGCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCACTCT