Description :
From Genome Similarity Track
Location :
Scaffold_3198:2- 1654
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3198-snap-gene-0.1Myosin

Sequence
1652 bases(100 bases per row)
GGCAAGACCGAGACGACCAAACTGATCATGAATTACCTGGCTTTCGTGTCGGTGAAACGCCGCATGCTCAAGCGCAGCGACGCGAGTCTTCGCAACTTGA
ACGGTGGCAAGGAACAGCCAACCATCCACGACCGCGTGCTCGAGTCGAACCCGATCCTGGAAGCATTCGGCAACGCCCGAACGAATCGCAACAATAATAG
TAGTCGTTTCGGCAAGTTTATCAAGCTCGGATTCGCTCAAACTGGCGAGATGCTCGGTGCCTCAATCGCGACCTACCTTTTGGAGCGCGTGCGGCTTGTG
TCGCAGGGACGAGGAGAACGGAACTACCACATCTTTTACGAGATGCTCAGTGGTGCCTCCAGCTACGAACGCGAAGAGCTGGATCTTCTCGATGTCAACT
TGTACAAGTACCTGAACCAGTCGGGGTGCGTCGAGCGACTGGATGGTGTGGATGATGGTGATTCGTACCAGCGCACGCGGCAGGCGATGACAAGTATCGG
TATTGAGCAGGAGGAGCAGATGGATGTCATGCGCGTCGTGGCGGCAGTGCTTCGGCTCGGTAACGCCGAGATTATCACGGAGAAAGGCAAGGATACGTCT
CAAGTGGATATGTCTACGTCCTCGGAGAGCATCGACTCCGTGTGTCGCCTACTGGGGATCGAGTCCCAAGTCCTGCAGAACACACTGTGCACGAAGCGGA
TCCGCGCTGGTGCGGAGTACATCACGGTGCGCCTGCCGCTCGACCAGGCACTTTCGACGCGCGACTCGGTGGTCAAGAGTCTGTATTCGAATCTGTTCAA
CTGGCTGGTTGCGAGAATCAACAAGTCTATTGAGTACAAGGAAGAGCGGGGCAGCCAGTTCATTGGCGTCGTCGATATTTTCGGCTTCGAGATTTTTGAG
GAGAACTGCCTCGAGCAATTGTGTATCAACTACGCGAACGAGAAGCTCCAGCAACTTTTCGGTGGCTTTGTCTTCAAGATGGAGCAGGAACAGTACGTCG
CCGAAGAAATTCCGTGGAAGTTTGTTGACTACCCGAACAACGACGTCTGCGTGGCCATGCTCGAATCGCGTCAAATGGGTTTGTTCGCCCTGCTCGACGA
GCAGTGTCTCATTCCGAAGGGAAACGACGAGAAGCTCGCGAACAAGTTCTACGAGATGTTCACAAAGCACGAGTCGTTTGGCGTTTCAAAGCTTCAGCAA
GCGAAGCGCCAATTTGTCATTCACCATTACGCCGGAGATGTGTGCTACTCGACGACCGGATTCTGCGACAAGAACAAAGATCACATGCACCCAGAAGCTG
GTGATCTGATGCGCACTTCCCGCATGGCGTTCGTGCGCAAGATTTTTGAGCAGGATGATGTCACGAAGAAGGCCGATGAGAAGCCGGATACCCGCCGTCG
ATCGGGCATCATGTCGTCCACTGTGGTGGCGCAGTTCAAGAGCCAGCTCACTTCAATGCTCCAGACCATCAACGCCACGGAGCCGCACTTTATTCGATGC
ATCAAGCCAAACGATGTAGCTAGTTCGTGTGAGTTTGAGCGCAAGCGCCTGATGGAGCAGCTTCGCTGCAGTGGTGTCCTGGAAGCTGTCAAGATTTCGC
GCAGCGGCTACCCTGTGCGCTTTCTCCATGAAGACTTTGTCAAGAATTACGC