Description :
From Genome Similarity Track
Location :
Scaffold_762:2- 1643
Sequence
1641 bases(100 bases per row)
CGGAATACTTCCGTTCGAGCCACGCCCGTACGAAGGCCCTCTATGAAGATGGTAACCAAAACCAATTTCTGGTAAGGCATCAAGCTGCATGGTAGCGATT
AGAGTTCTCAGTTCCTGGACGTAGTCCGATAGTTCTTTCTTGCCCTTACGGGCAGATAGAACCGAGAACGCACCCGGTATGCCTGATTAGGCGGAGAAAA
CACCCGGGATATTTGCTGTTTTAGTAAATCCCATGTGGGGAAAGCTTCGTCTACCGACGTGTTACACGTGAGAGCCCATTCTCTGGCTCTACCACCCAGT
TTTGAGATAGCCATCCCAACTCGCTGTTGCTCCGACCGGAACATAGCAGAGTTCATAGCCATTTCCACCTCTCTGATCCACAGGAGGAGATTCTCCCCTT
CTTTTCCTTTAGATGTCTTTACAGTCAAGACAAGAGTGCGAGCCCTTGGCTCTTCATCAGGTATGGGAACATACCGAGTAGGCATAACCGATGCCAAATG
GTCGTGTACTTGTCCAATCAAAGTAGACTCAAAACTATAAAAAAGGGTCAAGACGTGCACGAATCACGTCAAGACCTTGTGATAGGATTATATCCACTTG
TTCGTTCCCGACTAGCGCTCTGAGTTTCTCCAGCGCTTATCCTTAAGCCTCAGAGAGGTTTATCTTTGTTTCCACCTTACAGATGAACAGTCTTTAACAG
ACTCTGGTGTAGATTGACTACGAGTGCTACCAAGTGTCGCGGAGCTACCCTTACTCCTTTGTCAGAGGAAGACTTCTAGACTCGTAGAGACCTTAGTATA
CTAAACTAAACGGATATTAACTTAAAGGGTCTCAAGTCTTGCAGACTTAGTGAGACTTGACTCTAAGTGTATGTACAAGCTCTTAAGCTTCTATTCCTGG
TTCAGGGGACTACAACTTCAAGGAATCACGTGGCACCAATGCCCAAGAGTACTTAGCCTTAACTCAGGCACTTAACTCTTACGACCAGAGACGTCTTAGA
AAGACACGTGTCTAAAACTGATCAAAAGAGGAACTGAATATATTTACTGATTTCTAGCGATAATAAACCTTACTTACGTCTTTAAGCTTAAAACTATGCT
ACCTAATCGAATAGTCCTCATCATAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCCTATTACGATAGATATCCTCTAACCATA
ACCGATAGGGTACGGAATTATCGCTTAGCATATGCGATACAAAAGTATGCCTTATCAGTGATACTGATCTCTTTCTGTGTGTACCACACCAATGTACCTG
GTTATCATAACCATTTGTGTAACCCCGTTACATCCTCCCCCACCAAAGAGTCGATACCCCCCGAATCGACATTCTTCACCTTTCTCATTGAGATAGCTCG
GAGAGAACAGATATCCTCACGGTTGTGTTCACGACACCTTGCGCATCAATGGCGAAGTCTTCGCTCTCCTCCGAGTCTTCGGAAGACATCATACGCGAAG
AGAACATCGTTGATCAGGACAATGACACTGTACTGGAAGAGAGTGGAACCCCCGAACCTGCCACGTCAGCGTCGTGCGAATCTTCTCGCATAGCGCCAAA
CCCATTTCCGGAACGAAGCACGACTCAAGGGCTAACAGCGT