Description :
From Genome Similarity Track
Location :
Scaffold_2815:2- 1642
Transcript NameFunction/comments
Phypl_g15413hypothetical protein PHYSODRAFT_485789

Sequence
1640 bases(100 bases per row)
AGGCCAGGTGCGAAGACCAAGCTAGAAGCTCGTTGATGGTGTGGCCTTTTTCAATGACACACgcttcaagacgctcgacagcaagtccacccgccttgag
ctgcttcagcgatgaatagtggcgcagcaggtaTGTCATGAGAGTATCAAGCACCCTTCCATTCACGTTGTACTGCGCTGTCTTGAGTCCATAGGACGAG
TTGAATAGCGCCGATGCGACGGTTCGAACCTTCGTCTGGGTGTCGGAGTTGAACCAATCCAGCGACAAGAGAGACACCACTTGATCAGGATCCCGGCCAC
TCAAGACGCGAGCGACCTTGTGATCTTCGGCCGCTGTGTTGAAGACGTACGCGAAGGCCTTGTTCGTCGCTGTCATGTTCCAGGCCCCCCGGTCGAAGAT
CCACTGGACACACAAGCCGGCTCCGTTGGCGTGCTGTGCTCCACCGCGTCGAAAGGAATGCGATGTGGGGCGCTCAGTCACGCCAGCCTGTTTAGCAACT
CTCTCCAGGACGCGGTTGACGTAGCTGTGAATGCCCGGGGCAGCATCAGTTGCCTTGCCTTCATCTGAGCGATTTGGTTGTAGCGGTACAGCAGATCCTG
GATGGTCGACCAAGTCGATGAGAGGCGTAGCTGGAGTCAGAGTGGCTTGGGAGCTTGCCTCAGGTGCAGGAAGCTGGCTCAacagcgctgccgtcggaga
AGCTTGGGTCGCCAGTGCAAGCGCAATCGCGAGCAGTGGGCACGTGGAGAAATCGTCGTCAGGAAACAGCGAGAGGCCCTGTTCTTCGGCAGTCTTGATC
CGCATGAACcgcacgaagaagacatcGCCCGCGCCGATGGACAGGTTAGCCTTGCGAAGCAGCGTAAGGTCCGACGCACGCCCGAAAAGGAACCAGagca
agcacagcagcgcggcgtcctgGTAGTCTGCGGAGGNGTGCCCGACTCTCTCTTCAAGCAATAGCGTTCCAGTGTTTGCcccttcttgagcagcgtcttg
tcAATGGCCGCTCGATGCTGAGGGAACTGATCCAGCAGCCAGTTCTTCGCCTGTCGGTAGTACTGCATGACCGAGTTTCGAGCCAATAGCTTGTCCTTAC
GGCCCTTCTTGAAGGCGAGGTGCATGCCGAACTTGTCCACCACAGCTTCCAGGACAATCGCGgcacgctcgcgctgcatggCCAGTTCCAGGTACTCCCA
ACTgacgtcttcctcctcgatgaactTCAGAAACGAGCGCGCTGCGGACTCGCGAGCAAGCTTAGTTTTTGCCGGTGTGAGGTCGTTCAGGCTCATCTTG
CGTCGGAGGTGTCGGAGCTTGGGTGTTATTCGAGAAATATGCGAATGACTTGCCATCTGTAGAGAGATAATAATAACTTCAGTGCTCCCTCCGACCCGAT
ATGTNTTGCCATCTGTAGAGATATAATAATAACTTCAGTGCTCCCTCCGACCCGATATGTCGGAGGTGTGGCTGTGAGGCAGTCACCAATCCGCGACCta
tctgattggtcaaaattgTTCGCGCAGATCAATTTGATTCGCTAAAAGCCGAGATAATACCAAGTAATCAAATCTATTGGTCAATAATATCAATAGTAAG
TTCAAGTATTGTCGGAGATGTGACGATATTCATCCATATC