Description :
From Genome Similarity Track
Location :
Scaffold_3146:2- 1640
Transcript NameFunction/comments
Phyag_g13072putative polyprotein

Sequence
1638 bases(100 bases per row)
ATCGCTCTCTCTATGCAGGGCGCGTGTCATGGCGAACCCATCCACGACCCGGACGTGGGTGAAGACTTCGCTCACATCGAAGCCACTTCGGTGTTTAACG
GAGCGAGCCAACCAGTCGATCTCCGGTTGATATCGCGCCAACCACGGAATCCCAAGGATGCAGTCGAAGGCGTAATTCAtcccaagcaccaagaaaGTAT
CGTTGCTGTGAAAACCATCGAACGTGTATGACAGTGCGAGATCGCGCCGCGGTACGCGGTGGGGCTTGCCGTCGGCCAGCTTGACGATGACATCACCTTG
GCCGTCGCGGACTGGTATATCAGCGGGGAGCAGCGACACACACGACGCCCGGAAAAAGTTGTTCGTCGCTCCAGAGTCGAGTAGAGCGCGGAAAGGTCGG
CGCgcaccagcgacgtgaaggtCGACAATGATTAGCCTCGGGTCgccgctggtggtggtggcattgAACTGTGCGTAAAGCACGGGGGGGCTAGGAGGTT
GGGTTGTCACCGGGGGACCCGGACCTCCATTCCAGCCAGTAGGGCGCCCCGCACCTACTGGGCCCGGTCGTTTTTTGGCTGACCGACCGGAGAAGGATCG
TCGGCTCTGGCCGCGGCCGCGTGTGCGAGCACCGGTTCGGGTGCGCGGCACACCGCCGCGCGGTGGCCAGGTTTGCCACAGCGGAAACAATTCAATGGAC
CAGACCTTCGAGCACCGCGGGCGAATGAGCGCCCACGGTTGTTTTTAGCTTCAATGgcgtcgatctccatcaGCTCAGGGGCGGACACCCGGTTCTCCGG
AGTTAATGCTCGGGAGTAGGAGGACGACACTGTGTAATCCTCGCGCAGCGCGAGGGCAAATGCTTCTTCCAGGGTCTTCGGCTCGGCGCGTGTGAGACAG
TAACGCGTCATACCTTCGCGCAtaccgaagacgaagacatggACCTGTGACGCTGTGTCAATGGGACTCGTGACGATACACGAGCTCAGGTGTCGTGTCT
TCTGGACGTAATCCCTCATGGACATTCTGCCCTGCTTGAGCGCGAAGAACTCGGCCCTCATACGCGACTCGTCTTGTGGGGGCTCGAACGCTAGGCGCAG
GTCACTCTGGAGACTCTCCAGGGTTGGAAACGCATTCTGATCAACAACGATCTTGCCGAGGGCCCATTCCTTGGCCTTCCCTGACAAACGAGATAACAGG
AAGTTGATCTTAGCCGATGGTGCCTCGAGTATCCTTGAAGCGATCGCGATATCGATCTCGCGGAACCAGCGGTTCAGGGGCAGTCGGTCTTGACCGACGC
CTGAGTacgtcgacgtctccatcttcacaGCGTCGTGACGCGGGGAATGCGAGGGAGTTGACACTCGCCGCTTAGCGCCGGCGAGCTCGCGTTCCATGAA
CTCTTGGGCAGCCTGGCGGTGTTGGTCAGCCGTCGTTGAACTCAGCAACGACGCAACGACGAACTCTCCGGAGACAGCGGCCAGGCGGTGTAGCGCTTCC
CATTCAACTCGTGTGAGATGCGGGAAGTTTTCGTGCTCTAGGGTCGTTCCGGACACACCAGGCATCGGGACTTGGCTCATCGAAAACTTGATCCTTGGAA
GGACTACTAAGTGCTACCAGGTGTAACGGGGCTAGATC