Description :
From Genome Similarity Track
Location :
Scaffold_586:2- 1606
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20419hypothetical protein

Sequence
1604 bases(100 bases per row)
CCTCTCATCGACTTTATTTTACGCAAGAAGAGAAGGAACCGTCGTGCAGCGTCAAGTAAATCGATCACCAAAGTGTTATATACTTCGGCTACCAGGATAG
AAACTAGCACCAAGGCTGTAATTATATCGGCTACGTCCTTGGCCTTGGAGGGAGCCGGAAGCTTGTTCTTTCCCGAAAAGTCAGTCATATCATGAAGACA
TAAGAACTCGCGCTCCTCCCCCACATCCATTGGCGCAAAGTGTATCACAGAAAGACCGCAATATTCAAAGTCCAAACCGTAGAATCCGCGGGATGCAGCA
GGGTGTGGCAAAACATCATTTTTTTTGCGTGTGACTGCCAGGTATCACAGAATAATTGCTCATCAAGAGATGCGTACATACCGTTTACAAGATAGTTGTG
CACCGTTGTTTGCTGTTGACTTGGCCTAAACTGCGATTTTGGGTCCGAGGACGCCGCCTTCACCAACGTTCTCGGGCTGCCTTTGCCAAATTAGCCTGGC
GAAACGCAATTACTTGATCAATCTCCCTGATCATCTCGGGGTCATCTCCCAGTCGACGGCGCAACGCCAACAGTCGCGCTTCACTCGAGGGCTGGAGGGC
TTCAGTATCTCTGGCACGCTTCCCTATTTCGTTCATCTTGCTTGATAGGTCGTGCTGAAGGTCTCCACTGGGCAGCAGGTCGTCATCTGAGTCGCCAAGT
TGCTCTATGTTCTCCTCCTCAAGATTTCCTGCCGGCTGCTGCTCCGATCTCATTACCTCGTTTGCTTTTTCCACCGAGGTAATTAGCACATTCGGTACAA
CAACAACCTGATGTGCTCGTCGACTGTTTCGTGATAAAACACGTAATTGAGAATATGTTCAATTGATAAGTAGACCACGCGAGTTGCCTCTACATCGTAT
AGCGGAATGTCCTGGCTCTCATCCACTGGAGTCATCGACAGCTTTTTCAGAACCGTGGCAACACTCCTCCTCGCTGCTTGACCTATCCCATTAAAATGAT
AATACGCGCTGGTATCAACAACTCTCATTTTTAGCATTATATCGAGTACGCTACTCATCCGACACGGTCGCAAGGCGTATGTCTCCAATGCCAAATCTTG
TATTTCATCTTCACGAAAGTCCAGTTCAGAGGTCATCACTGAAGGTGACCTGCAAAGTTCCTCAGCCATCCTTCCAGGAGTACCCGACCACGATGCCATA
GTCCCAGACTTTTGGTTTTCCATTCGGAACCCGGGCGATACACACCGCACCACCCACATACGTACCGATCCCACTCATCGCTGCTTCCTCGGTAACAGTA
CTAAACCCCACCCCGGCAATCTCCTTCTTCGTGGTGCAGACCCCAAGGTCTTTCCGGCGACCGCTGGATACACGCTCGACACCCACCTGGCTATGTTCAG
CGTCCGAGACTGTCTTGCCGTAGGCATATCCGATTGTCTCGAGCGAGTCGGGCTTTAGGAGCGCGTACCACGTGCAAACAGTCTTGTTGTTGCCCAAAAC
GGTGCAGGCGAAAGGTCACCAAGGCTAGCAGGTTGTCGAAAACAAAGGAAAAAAAAACAAAACTGAACTCGGCTGTTATCAGCCTTGCTCCTCTCAGCTC
CTAC