Description :
From Genome Similarity Track
Location :
Scaffold_2038:2- 1599
Transcript NameFunction/comments
Phyta_totarag14032hypothetical protein PHYSODRAFT_339130

Sequence
1597 bases(100 bases per row)
gttagtcggtgtctgggcgctgttggtaagccggatccagcaacttcgcagattttgctgatcccgtTACACCACaatggtgcgcgtgcccggatCTTTT
GATGACTCAGGATTTTACCGTGAatcccaagaagaagttcaagtgAAGACTGAACAAGGAAATCAAGCGTCGTCGGAGATcggatcgacgacgacgccgc
tgaATGAAGCAAGATCCGCAGGTCGACAGAGTACTGGGAGGGACTCTGTCGACAGAAATTAGGGAGATTTTGAAACAGATCTAGAAGAGAAACCTCAACC
TCCTCCCCAGGTCTCTTCGGGGACCTCAGCGGATCTTGATATATATCGATGTCTGCAACGCAAAACCGGTAAAGGAAAACCGGAACCGTATGCGTTCATG
ACGGACGAAGTGACCGCAAGCCCGCTAGTCCCAATGTCTAatacgaagaagaagaaaacgaagactacgcggaagaaaatgaaggcaCCTGGTTCGGAAG
GCGAAGGTCAGAAGGAATTTCCATTTACAGGGaccgagcaggagctggaatTCGCGTTTCACCACAAGGCGCTACGCAACTTGTTACTCCAAGATCCAGT
GATGAAGATCATGAAAGTACAGCAGATCGGAGATCTGAAGTGACCAGTGTCAGCTCCGCCAGAAACATCCAACAAGCTGACCGTGGTCAAGAACCTACTC
CAGATACTGAAAGAGGCAGGTCTAGTTATCGGTGCTTTCGACGCTGACGGATTGTTTGATCTGGACTTAGAGACCGTCAAATCTACTTCCCGAGAGTTTT
TCGCTAGACTAGCGATCTTGATAGGCGGAAATGGACGGATCGAAGATCCAGAGATCTTGCCCCGGATCATCACGACGGAGTACCAGATTAGCTCTTCACA
TTACGCATCGGCCACACTAGAACCTGATTCAGATTGATCTATAGGGCCGCAACGTATGCCTCTCGGGCCTTCCGCAGAAGCACTATTGggatctcgatct
cgtgggAAGTCCCCGGATCGGACACAGCCGCGACAGCAGAGGCCGCCGCAGAGACAGCCAAACCAGATCACGAACGTAACTTCGCCGGACGGGTCAACAG
GCAGACTGAAATCGTACTTCCAAGCTGCTATGAGCCGATTCCTCAAAGAACAGCAGATCACGGCACCGAGCCACGACAAGGAACGTTGGCGCGCAAGATG
TGGACATGGAGTCAGTCGGGTCACCCGATCGCCACCCCGCTCTCTGGGAACACGACCCCGACGATCTGGATCCGCGCTCATCCAACGTGTGCGGATCTCA
GCCATCTCGGATCAGAAGGAGTaagatcaagatgaagatcggGCAAGAAGGTGGATCAGCAAGGTTAAGTCCGCATTCTTGCGTGATGAGACCTCTGACG
AAGGGAAGTGTTTGACATTCAGAGATCTGCTGATGGTGCCTGCGCGGAACTGGCACCGTCGGTTGAGCCGAACAACGCAAAATAAGTGGAGCGATCTACT
CCGCAGCTTCCAGACCCAATACTGTGGTCTCGGCGTCTCAGTCGCGAGGCAATACTACCACGAGCGCAAGAGATCGGACGAGATCCCGTTGGAATAC