Description :
From Genome Similarity Track
Location :
Scaffold_3192:2- 1598
Transcript NameFunction/comments
Phypl_g15674putative polyprotein

Sequence
1596 bases(100 bases per row)
TTGCCGGAGGGGAACCTCATACTCCCATGAGTTCTGTGAGTGGGGATACCCCCTCCACTTCACCAGATACTGGGTACGAccctggcgacgacgccgtgcc
AGCAGGCATTCCACGTGATAGTGGCGTTCTCCCTGCTCATCGAGCAACGCCGGCGGCGGTCTCCGACCAGCTGGATCCTCGCGCTGCGAGTCACTACGAC
CTCTTGTCGGTTGAGAACCGAGCGTAGTCTCCGGAACATTCCGTTCCTCAGCgtgtcgctgcgctcgagcgTTTGCCCCCTGATCTGCGTGGTCAAGTGG
ACCCCCTGATGCACATCCAGTGCTATGGTCAGCAGTCACCACCCGTGGCGCTGCCACTCTCGTCCTTCCAGGCACCAATGCATCTGCGCTCACCTGAGCA
GGATCCCAATACGGCTTAAGCAAGCCAACGTAGAAAACTGGATGCGtgcgcatcttcttcggaAGATTGAGCGTGTACGCAAGgcccttcttggccacga
NTCTTCGGAAGATTGAGCGTGTACGCTAGGCCCTTCCTGGCCACGACCTTGAAAGGTCCAATGAAGCGCGGGCGCAACTTAGTCTTAAAGACCGCAGACA
CTGCATGTGTAGGTAGGTTTTTAGCGTTTAATAAAACTAGGTCACCGACCTTGAACACGTCAACGCTGCTTCTGCCTTTTGCATCAGCCTGTTCCTTCTG
AACATCCTGGCTTTCAGCCATCGCGTCGCGTACTTGCCGTAAGACATTCAAACGCGTGGACACGAACGTGTCAACTTGTTTGCGAACCGCAATTGGGCTG
ATATCAGCTAGCCCTTCGGCTATTCCTCCCCCACTAAGCCCAGAACCACGCAGTGGTAGCGTCAACGGGACGCGAGTGTGTGTGAGGCCGTTTACATAGA
ACGGGGTGAGGCCTGTCGAGGCATGCACCGCATTGTTCAATGCAAACTCAACGAGTGGGAGCATGNCATGTCTTCGACTACGCGATTCACGCGTTCAGTC
TGACCATCGGTCTGCGGATGGTCCGCCGTGGACATGTCCAGTCGAGTGCCAAGCACCTTAAAGACTGATGTCCAAAACTTGCCCGTGAAACGGGGGTCTC
GATCCGAGACAATCGCCTCCGGCAGCCCATGCTGGCGGAACACGCGATCCATAAACAGCGTGGCTgttccttctccatcgaTGGAGTCCGGCACCGCCGC
TAAGTGAGCCATCTTGCTCAATCGGTCGACAAAGACCACGATGCCCGTGTTGCCCGCCGCATCGCGCGGCAGGCCGAACACAAAGTCTATGCTCATGGAT
TGCCAACACCCCGCGGGTACAGGCAAGCTGGCCAACGGCGCAGCCGAGTGCGGCGAGGTTTGACCCGTTGACACGTCTCACACGTGCGTACATACGTACT
GACCCACTTGTACAGCTTCGGCCACCAGTAGTGGGTGCTCACCGAGCTGTAGGTCTTCTCGCGACCGAGATGGCCACCAAGTGGTGTATCATGTGCCTCA
AAGAGGATCCGATACTTAAGATCCTCATCGTGAGGGACCACGACACGTGGAGTGTCCTCCGGACCCGTACCGTAGTACAATAGGCCGTCATCGAGT