Description :
From Genome Similarity Track
Location :
Scaffold_4021:2- 1582
Sequence
1580 bases(100 bases per row)
CTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGA
CCAGCGAGATCTCCAACTCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCAC
CAATCCCAACACAGTCTTGGATCCGACTCCCATACACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAG
GAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCT
GTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGGTCTGCAGTGACCTCAGCCTTGGTAGGCTCAA
ACCATCGACCTTGTCGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTG
GCGCAAACTAGAGATCTTGGCAGCTGGCACTTCATGTAGATCACGTGGATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTC
ACAAATGCATAAATGCAATACCTAGAACGTTCGGCTCGTACCGGATTCAAATCCGGCGAACGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACAT
CCCTCGGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCCCGCCACAACCGCGACAC
ACGTAGAAGCAATGATCCCCGGGATGCCCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCACT
GCGAACACCTGACTTGTGCTGTCCCGTCCATGAAATCTCGGGATCTTTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGT
CTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGATAATCTTCCGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTTAGTCGGGC
ACCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAAGCGTCGGAGCTTTTTGGCGATACTTGCCGGATCCGACTGCCGCCTTCTTCTGGCGGTGTTTCG
CGCGATCCACCGCCCGCAGCACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGAT
GAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGC
GGGGATACATCTGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAA