Description :
From Genome Similarity Track
Location :
Scaffold_111:2- 1575
Transcript NameFunction/comments
Phyca_LT1534537727AP2 complex subunit alpha putative

Sequence
1573 bases(100 bases per row)
gtcgtcagcgtttagctttggagctgggccggaagcgatccgtggtcccaacccggcgtcaacagacttgggcaacatctttggcggctcaagtggtgga
aaaccagtcggtcttgactcgtcgttggccccgcagatcgctgtttgggctcgcaacctcatgttgaacccccagggtgttctaatcgagaacgacgtgc
ttcagattggtgccaagcacgaatatcgcggctcacaaggccgaatcaacctgttctacggcaacaaaactaccgacacgctcaacggcttctcggtaca
gctcgaaacaggcaattccttccgtgttcagaccgaggagctgcccaattcgctgacagggaagcagcaggccaagcaacagatcatgatcgaggcgatg
gcacctttcacggagccaccgatgatgacggttaacttcacacgcaatggaacgagctacgcctaccgagtgggtcttccctgccaggctacgaacttca
tggagccggtcgcagtgaatgaagaggcgttcttgcagcgctggaacgcattggaggggcaagatcgtgagcagcaggaggtggtgccggcagttagcaa
gttggacatgactcaagcgcgcgaatggatcagtacgaatctcaagttcgccatgatcgacggattggattcacaagcgagtggtagtttatctgcggct
gctacttatcgcacgggggcgatgggtcccaacggcgataaactttccgttggctgtcttgtgcgcctggaagcttgcgacggcaacagctaccgtatcc
gcgttcgggccgtgcatcgagacgtgagcgtagcgaccaagaactgcctcaagatgctgcttcaagcgtagagcagtagttgatgatctatgaactttac
cacctgcagtgcacaaggacagccaaagtaaatgataaaaacagtcgagcaatcttctgtgctccagaagttttgcgtgttgaacccgttgctgccgaag
gcactaacgagacaaagtttccatcttcgacagatacagtagtgtgcaacggtgacttgaaggctcaaattgaagcttacaactcacccttcgttgctca
caaaagtgctcagcaaagtgatcactaagaacttgtagcctacattaatccaaatcgtacttgtgcactacaacttgtactgaagtactgtagtgaacga
tttcatgcgatctgtgttttcctgttgacaagaggcttgttgacgaacaccattgcgctggtagataccgctgaatcatgctttcctgttgggatgggaa
ttgccccggcccgacaggatctctcttgaatcaaaagccttgatctcaaggtcagcaatgttcttgcagagagtcctgtttcggtggaatcggtccgaca
tgtcgttctccacaaaatgctatccttcgtctcgacaacaaccacagccgagaatcgtcactcaacaacttgaaacgagattgatggcttggatttcaaa
gccagatagacgcgggacgatctagacattcgtgaaagtcatccagatcggaaccaggctttcgcttgcagag