Description :
From Genome Similarity Track
Location :
Scaffold_360:2- 1536
Transcript NameFunction/comments
Phyin_T30-4PITG_21439Putative uncharacterized protein

Sequence
1534 bases(100 bases per row)
TGATCCTAGAATTAGAATCCATAGTCGCTCCGAGCCAACGCCAACGCATACTGAAACAGACCAACGAAAATAACCGAGAAGACCCACAAGACTCAAAATT
TGCCATAGAATTCCCCATCTTCCTCTTCGACGACCAGGAAGTCACAATCGGCGGTGCATATTTGCACATCAATCAGAGGCTCTCATGACTCGGCGTAGTT
TTTTTACCTACCGGTACACTCAGGTGTTCGAGTCTACCGGCCGTCCTGCATTTAAACCTTGTTGTATCGCATCTGCTGGCTGAAGGATAGACTTGTCTGC
ACCCGTGTCTGGACACATTCAGATCCCCACGGCTCTATTGATCAGACCTGTGTACTCCTCGTCATTTAACACCTTGCTCACTTCTTTCTCTCCATCATCG
GGTCCAGCGATCTCTGTCGACGGTTTCCCTTCAGCTGCACGCTTGACTTTCCAAGCCTTATTCTTATGTGACCTGGCTTCTTTCTTTTCTTCAGGTGCGG
CAGTTGGGCTATCTCTTAGCCAATGTTCACCCTTGTAGTGAAGACGTCCTGTCCGCGGTGGCGGAGTGTATCACGTGTCGTGTTGTGCGCCCCCCCTCAC
TTTTCCGCGGTTCGGCTGTTGGCTGCCCTCTTTTGAGCTCCGCTGCGTGCTTAGCGACCTATGGGCGCCTAATTTAGCTGCTGTCTTTCCACTTCTGCGG
CCGCTTGCCTCTTGACCGAGTCAGCCGGTTATAGCAGGGCTGCTGAAGATCTGCTCCAGCGCGTAAAGCTTCTGATAGTTGGTACGAATGTGCTTATACG
TTACCAACTCTAGCATTCCCTTGACCACGTCACTTAAAATTGTCAGCGAAAGGTCATCCACCAGAATGTTGGTTCGCTGCTTCATACAAGCCGCGTAATC
CTCTCGACTATAGTGTAAGAATTACGGTAAAATCAATGTATCTCAATAAGTTATATCTCAATTTGAAGTGTCTTTCAATGATTTTGTAAGATAATTTTAT
TTATATTTCGGGTGATAATGAATACTGCGAAGTATCAATTAGGCGTATTTAAATGTAAATAAAATGGATATTACGATAGCTTCCCCCATTTCAACCGGAT
AACGGATACCGTGGACGCCATGGCGACGGCCTCGTCGACGCCAACATTCTCTCACAAGCAGCATCTTCGTCTTCTGGAACCGAGCCAAGCCGAAAGCGCT
ATCCGCGATATCTTCAGCAACGTTTCGGCCGCGGACGTTCGTCAACAAGCGGGAAAGACGGATGAGAACGCAGGTGAGATGCTGCCTGCCGCTATATCAA
GCGTGATTCAAATGATTGGAGCTGTGCATCGAGACGACGTCTTTCTTGACATTGGTGCTGACCTGGGGAATGTTGCGGCGCAGTTTGCGATTCAGACGAT
TGCAACGCCAATGCTTGGAAATCGAGAAACGACCGGAGGTTTTTCTTCGAGGTGTTCATTGTTTGCGAGAGCATGCGCCAAGGCTGCTATTACTCCACAA
AGTGTTTTTGAACCAAGGAGACGTTCTTGATACG