Description :
From Genome Similarity Track
Location :
Scaffold_3487:2- 1529
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3487-snap-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
1527 bases(100 bases per row)
GACAAGATCGTGGTGTTGGCTGGCGGTGCGGTGGTGGAAGAAGGTCCTCACGACAGTTTGGTCCAGATCAAGGATGGTGTGTACCGCAACCTGTACACGA
TCCAAGAAGAGAAGGCACAAGAAGAAGCTGAGGCTGCCGCCGCGGAATTAGCGAACGCACGTGCTGGTGACGAGATTGTCGAGATGGTCCGCAAGGACAG
TATCCGATCTGTGAAGAGCGACCGAGCCGCTGATGTTGAAATCGCAAACGATGAGAGCACTCTCAAGGGCAACTTCACCATCCTTGACGCGATGGCGTTC
AGCCGTCCCGAACGCAAGTTTTTCGTCATCGGCATGATTGCCGCTGGTGTGAACGGTTTTTCGCTTCCGTCTTCGGCTATCTTGATCAGTGAGATGGTGG
CTACAATGACGTTGAAGTACCAGGAGTTCAAGAGCGACGGACTGCACACGCACCTGGACTCTCTGTCCGACGACGTCACGCTCTACGGTCTCTGCTATGT
CGGCGGCGCGGTTGTGATTTTCGCGTTCACGGTGATCCAGAACTTCTGCTTCAAGTATATGGCGGAGAAGCTGACGTCTCGTCTTCGTGATGTGCACTTT
TCTGCTCTTTGTCGTCAGAACATTGCGTTCTTCGATGAGAAGAAGAACGCGACTGGTGCGCTGACCGCTGATTTGTCTACGATGGCAACGAAGGTTGCGC
TGATCTCTGGCGACTCCCAGGGCCGCGTTGTCCAAGCTGCGTTCACTTTCATCGCGGCGTTGGTGATTTCGTTCGCGACCGGCAGTTGGCTGCTGACGTT
GATCATGCTGGCCGTGTTCCCGTTGCTGTTGATGGGACAGATCATCCGCATGAAGCAGATGCGTGGCAGCGGTGGTTTGTCTGACGAGCTGGCGGATGTC
GGTGCCCACGCCTCGGAGGCACTCAGCAACATCCGCACGGTGGTGTCTCTCAACTTGGAGGAGTCGATCTCGGACAAGTTCTCAGCTTTGCTTGAGGCCC
CACTGAAGCAAGGTCGTCGCGAAGCTCAGATCAACGGTCTCGCGCTCGGTTTCAGTTCGTTCATCGTGTTCGCCACGTACGCGTTGGTGTTCTGGTACGG
CGGTCAGCTCGTTAACAAAGGAAGCATCAACTTCAAGGAGATGATGCGAACGTTGATGGCGATCATGATGTCTGCTCAAGGTGTTGGTAGCGCTGCTTCG
TTCCTTGGTGAGTCTGAGCACGCGATCAAGTCCGGCCGTGCTATTGTTGCGATCCGTGACCGCGAGTTGCCGATTGATTCGTTCGATGAGTCTGGCGAGA
AGCCTGCCAAGGTGGAGGGCAAGATCGAGTTCAAGAACATCACCTTCCGATATCCGACGCGCAAGGAAGTGACGGTACTCAAGAACTACAACCTGACTAT
CGAAGCTGGTCAGACCGTGGCGTTCTGCGGTCCATCGGGAGGTGGCAAAAGTACGTGCATCTCGCTGATTGAGCGCTTCTACGATCCAGTGCAAGGCGAG
GTGCTTCTCGACGGCAAGAACCTCAAG