Description :
From Genome Similarity Track
Location :
Scaffold_310:2- 1494
Sequence
1492 bases(100 bases per row)
ATGGCGCCGCGCCACGCTGCGCAGCTGGCGCGCGGCCTGCCACTCCTTCCAGGGCCCCTGCAGGCGGCCGGAGCCGTCGCGCCGCAGCTGACCGGCGCAC
TTGACCACCACGGGGCGCGCTGCGGTGGGGGAGGCGGACGCAGATTGGGAGGAGGACGACGAGGAGGAAGGTGCGCTGCTGCGGTAGACGTGGCCCAGGT
AGATCTGCGGCGCCAGGCGCGAGCTGACCTTGATGTGGCGGTGCGCGGCGGGGCGAGCTGGCGGCGGCGCTGTGGCGCTGCTATTGCTGCTATTGCCGTC
GTTGCGGGCGTTGTTGCCGCCGCGGCGCGCGTACACGAGCGTGGCCGTCATGGGGGGTGCTGGGGAGTGGGGGTGTTGTCGGGCGGGGCGGAAAATGGCA
AAGTGCGGCGAGGCTTGAAGTTCGGGCGGCAACTTGGTGGAGCCTTGCAGCGTAGACGGGGCGCTTCTGCCGCGTCGCATGTTGTCATCGCTCTGGGCAA
ATCGCCGGCCGCCACGTCGCCTTTACGGAGGAGCATAGCCGTGTGCAATGATGACGCGTTGCCTCGCCCGTGCAGGCTGCAGGCGACAGGTTGCAGGTAA
ACCTCGGCGTTCGCTACTGGCGAACGCCGCGGTAGCGAATCGCTACCCGCCACCTTGCGCTTGGACCCGAGCGAGCTGCTACAGCGACGCTCCTCATTCT
TGGCGCAGATGAGTGCACACTGCGAGTCGCAGCTCGCCGGCAGCGCGAATCTCGCAAGGACAGGCTCGTCAAGGACGAATGTACAGCCGTTGCAGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGGCGAGATGCCTGCAGCGCGTTTGGAGAACGCTCCCCGATGCGGATGCCGGG
CATGCAGTGTGCCGGCCAACCCACGCTGACGACCAGCGCATCGACCGCGACCACAGATGGACCGCAGTGCTTACGACGACGACACCGCCTGTCGGTCGTG
TCGGTCGGACACTGACCTCGCACCGGAATCTCGCTATCTGCGCTGACTTCCGCCAGGACTTGCTTGCTCGTCGGTCGCTGCGCACGCGGAGCTCCCGGTG
CGCGTGGCACGCGCACCGGGAGCTCTATCGTCATGGCCACCACTGACGTTTGGTAAGTTGACAGTCATGGCATGTATCTAGCTACCTGTAGATGCATGCA
GCCACATACTTGTTGCTGCTCGTCGATCAATTGCGACCCATCACATCCGTCAATGTTCCGGTGGTCGTGCCACCTTCCGATTGGCTGATAATCACTCACG
AGCTTTTCAGGAGGACCAGACAAAAATGGCCCGGTTGGTGGCGTCGGCGCGGCGCTCGCGCCGATTGCTGACCGGCTCCCTGAGACTCGTTAGCGCACGC
GGCGGCCGCTTCTTCTCTGCTGCTGCCTCGTCCAAGACTCCAGCGGCACCAAACGCCAAGCGCCGAGTTGCTCTGGTGCGTTTGCTGCAACA