Description :
From Genome Similarity Track
Location :
Scaffold_156:2- 14533
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.14Ancient conserved domain protein 2 (cyclin m2)
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.15Adenylate kinase domain-containing protein 1
Pytap_DAOMBR444maker-pag1_scaffold_156-fgenesh-gene-0.5Protein kinase

Sequence
14531 bases(100 bases per row)
ACCAAAGCCCACGAGGCCCACGCGGATCACGTtAGTCGACATGGTGATGAGGAGCTCAATTGAGGAATGGCAGAGTGGAACGGTGCTTGGTGTCTGGGTA
CTGTATTTGGGTACCAGAGTGTGTGTAGGCAGCGTGTGAGTGTTGGTCTTACCCGCTGCGTCATCACATTGCCttCctcgagggaGTGGTGTATTACTCA
GCGTCTGGTGAGACGCCATGGTCTTCCGCCAATGACAGCGTCTCTGGAAACTGCATCGTGCAGCAGTGATTGgCTACTATTATGGGCGCCATGCATTTGC
GCGAACACCACTCCAGCTATCATAGCGCGATCCGTAGAGAGCAAGCTACAGTAGATTACGCTGTGCGTGCTCCATGGGACCGAGCATATGTGGTCCACAC
CCATATTGAAGAtaCTCGTGTCTTaTGGTCCACGAATTTCTCCCTCTACAAGTCATCAGAAGCATGATGGTGACAGCCATATTCGAGCATGATGCTGTGG
GTGAGAGtAGGAGAGAGAGCTAGAACTGAcGAAGCAAAaCAAAACGGCTAgaGGCTATTACTATTaTAGAGGCAAGATGCTGATCTCCAAAGGCCACTGC
GTTGCGACAGAGAGCTGAGTTCAGAGATGTTGTTCAAAGAGACCTATGCGACGTCATGCAAGGAGAAGAGGGACAGCAaACAGCCAGCCCACTAGTACCA
CAAACTCGCCTCCAACACGGCCATCGTCGACTCTTGCTTTCACTGTAGATGCCTCAGCTtGTTTACTGCCCTTGGACCTTTGACAATCtCTTCAACACCT
TGAGGTCTGTCTTTGCCaCCACAGTCGGGTCGTCATGAGTATTAGTACTGCTCGTGTGCGTGTGTCTGTGTCTGCGTGTtACTCCTTCATTTCGACCGtG
TgTTTCCTTTGTCATATTGACACTgTGGCATTCACATGAGGAAGTCGGTGCCGCGAAAGGTCACGATCTGACTCGGACTGTAGCATTTCAGGGTCcATTT
AtACCCCAATCGTGGCTAAACcAGGTGCAAACGGTTTGAATCGTGCCGTCTTTTGAAACAAAgcttcccctGgAGCTCTTTGACTGCATCATGGCGCCGC
CGACGAGCGCCGTGCGGGCGGCGCTACGGCTAGAAGGCGGAGCTGCGCGACTGGCTATACCGCATGACAGCGAGCGATGCCGCACGCTACTGTTGCGTCT
GCTGCGCGACGTTGTGGCGTTTGTTCGGCAGCAGGAGCTGCGGCAACCGCCAGCAAAGAGCCTCCTCTGGATCCATGCCGTCACTCGTGTGTGTGAGAGC
CGCATCGAGCAGCTCACACGCTCAGACGACGTAGCTGGCTCATGGTCAGCAGCCTCACCGCGCGAGGTCGTGACGGAGGCGATGGTGCGCGAGCTGCTGG
TGAGTTTGGCGTCGATCCGATTAGCGGAGACCGAGGCTATGGTGTTGGACGAGGTGGAGAATGTCGAAACGCTGCGTCATCTGCAGCTCACGCTCCGTCA
CGAAGAAGCAActttAAGGCGTATTATCCACGACGGCGCAGGAGAAGACGCGCAGCTGCGAGAGCTACAGAGCCTTTTACGtGAAGAGTTCCTGCAGGAA
CTCGCCCAGACGCGGGCCaacaCACTCGCAGACTCCATACACAACGAAGCCTCGTTACAGTTTGCATGGGAGACGATCCAAGAGCAGAAGAAGGAGATCG
TACGACTTCGAGCCGAGAACGAACAGCACCAAGCGTCAAGGAGAAGCCGCGAGAGCGAGATGATGGGTGGCATGCACGAACAGAGAAGAGtGGAGCCGGC
ACTGGCGATCCATGAGCTGCAACGTCAGTTGGCTGTGCATCCGAATGGGAACATTCGAGTGTTGGAGGACCAAGTCGCTCGTCTTGAGCTTGAGATGGCC
CGCCAGAGTGATCTACAGCGAAGCGTCTCCGGGGTGACGTTGGACTCCAGTCGAGAGGATGCagACGAGGGCCGGCGTGGATCAATGCTGCTGCCGAGCC
ACCTCACGACGTCTGCATACCGTCGAGAGTGCGATCAGTGCCGACTGCAGACGAGGAAACTGGTGGAATGCCAGTCAGAAGTTAAGCAACTACGAGTTCA
AGCGGCAGCTGATCAAGACgCACTGGTGGCAGCCGAGAAGGAACGTGTACAGCTGCAACAGGAGATCAGTACGCTGACACAAGCGCTATTGACTGGTAAG
CAAACACAAGAAGAGCTACGTAGGATGATTGCaGAAGTATCTAGCGACAAGCTGAAACTCCAGACTTTGtATGAAACTACGGAGATGAAGGGAACACGTC
AAGTGGAAGAGCTCACGTCTCAAGTGCcAAGTCTGAAGTACGAGTGTGAGCGCTTGAAACGAGACCTCGCTGAGTACGAACAAGTCAAATCAAAGTTGAC
AATAGATTTGGAGTCCATTCAAGCTGCCTACTCAAGCGTTGAGACTGAGTTGAAGACTGTAACAAATCGGCTCCAGGATGAATCCACAGCGAGAATTGAG
GCTGAGAGAAGGGTGGTAGAAGAGCAGAAGCATGCAAAGGAGTATAAGACAGCACTTGGTGCTATGACGAGCGAGATGGCGACGTATCGAACGCAGCTGA
ACAACATGGTGACTGCATCTCAGCATCAGCAACAATTGGAACGTGACATGCGAACACAAGTAGAAGAAgCGCAAATGGCTTCCGAAGTcTTACATCGAAA
AGTGCAGTTACTTGAAGAAGCGAGAGAAAAGCACCAAAAAGAGTACGAGGCGCTTCTGGCCCTCAGTATTGAGCTCCAGGACCAGCTACATGAGAAAGAT
GCGTCCATAGCCGAGCGTGACAACACTATCAGCCATTTGTCTAGGGATCGACAGCACGAGAAGACGATTGCACAAGCATTGAATGACCAACTTCGCGAAT
GTGAGCGCCGTCTCGAGCAATCTACGAGAAGGATCGCAGAGCTGGAGGGGCGCGTGGATTTGTCAGAGGAACAGAGGTCAACACTAAGGTCTGACATCGA
TGCACTGCGTCGGCGCGCCAAAGAGACGGAAGAAGAGCGCGGGACGTTGGAAATCGAGTTGAAAGAGCAGTATGACGAAATAGCGAGACTGGAGTTAGCG
CTTGCCACCGAACAACAAGCCCACTCGAGACTGCAACAACAGCTCATGACCTACGAAGAAGAACGCGTTAGGCGTGACCAAGATCTTCGCGAGAAGGAGA
GTTTATCTGCGTCAGCGTTTGAGAAAGCCAACAAATTGAGTGCTGAGGTGGCGGAAACGAAGACGACGATTCTAATGTGGATGGGCAAATATCATgcAcT
GGCTGATGAGAAGAACAAGCTTGACCTCACGAACGACGCGTTGGTGGCACGCGGCGATGAAACTGAGGCTGAGCTCTACAGCGTAAaGCAGGAGCTGGCG
GAAAGTgTGAAACAAGTAAGGGAGCTGCGTGCGTCATtATCAGAtCTTCAGCAAGagAGTAGTCTCCTCGAAGATAAAACcTCTCATCTGGAGAGCATTG
TGTCAGAGTTATCAAAGAAGACGCACGATCTGGAAGAAGCGGCAAGTCAAACTGaGATCAAACACGCCGAAGACATCATCAATGCGGAAACGTCACTGTC
tAAAGCCACCGAAGATGGAAAtATGGCCACTTTGAAACTCCAAGCTAtcGAAAAAGAACTAAGCCAAGCGCATGATGATATAGCAGGTTTGCGAGCAtGC
GCGGAAGCTTTGACTATCCAAATCCatGCCCGAGAATCGAGCCTAGAAACCCAGAGCGACGAGATTGAACGTATGACTACAGAtcTACAAGCAAGACAAG
AGCTGATCAACGAGCTCCAAAGAGAAGTCGAAGGCCGTCAGGATACAATTAGCGCTTATGCGAACCGCTGTGACGAGCTACAaCATTTACTAGAGCGATC
CGAAGCTGTGGCGGACGCGTTGCAGGCTGAAATAGCGCGCTTGAGGAACGAGCTCGAGGTGAAACaGATGCAGATATCAGACTTCCAGTTGCAGCATAAG
AACGAATGTGACATCGCAACGCGCGCAGCCGATGAAGTGTCCATGTTGCGTTCCGAGAAGATCATGTTGACCGAGGAGCTCCAAGAAAGCAGCATCGCGT
ACTTtAaTGTGGAGAAGCGATTGTCCGACGCTCTTGCCGCATTCAAAGAGCTTGAAATGCAGCTCGTGCATCAAGAATATCTGGATCAGAAGCTGCGCGA
CCGCTTCCAAGACCTACTGGCGACATATGAAAGTGACAGCAATCGTGTCTGGAAAGATATCGACGGACGActGGTAGCGATTGCGAGCCGAATCAAgtcG
GCGTCGGTGCAAGTGCAAACAACAACGGCTGCGgTGCTTGTTTCCACGAGAATGACAGAGACAGCGTTGATGtcGGATAGTGCTGcgCAGACGGTACctC
CAAACCATCGGGCAGCGATGACGCAGACAGATGACAAAGGCAACGGAGGTCTCCAGGAGGAGAAGGTCGTAGAACTGACGGACCACTTCGAGTCGGCCGA
CGAGACGAACCCAGATCGGAATAACACTCGCAACGGCGATGTtGAGTACCTTCCTGACTTTGAAATGACCTCTGATGTGTCAAGTGCAGAGTCGCTTCTG
GAACgCCTGGAAGATaTCTCagCTTTGGACGACAACCGCTCCATCGAGAAGAcACGCTTGGGCCTTGTGCATTGCATCACAGCCTTTGATCTCTGCTGCA
GAAACAACTTTCAACTCATGGAATCCACGCTGCATGCACTCGACATCCGCCTACGAGGCGCCGTTGAAAAAaCTGATAAAATATCTGTCCGCAAATGCCA
GtGTCTTGTGGTTGAAGACATCGAGTGTCCACGGGATGAAATGAAGGCTAGTGGCCGATCAGCGGTTTCGCTGGTGACACCAATTTCgCACTTTGAGAGT
GCGTGGGTGCAAACGGAGCCGCCaGCGGCATATCTATTGAGTCGAAAGTCGATgcAATTCGAGAAGTGAATCCCACGGAGTCAACGCTGCTGGTCACAAA
GACGAAGAGAACCGTtcGcTtAAAAGCAAAGCCCAAACCTGCCGTTGTGATCGTTCCAATGCCGACCAAgAAACCCTCGCACATGTCGAAAGGAGTCCAA
ACCATTGGAGAGCACCGGGAAGATgCAAAGGTAGTTCTTGTCGGCACGAGGTGGTCGATGCTCGTGCAGAAACTACTGGACAAGAGCAGTCGGTGTGGGT
TTATCCAGTTATTCAAGGCTAaTCTGCAACGACGATGGACCGAAGTACGAGTTGCGAATTtATTTGCTGGTTTGGCATTGCGACTACTAGCGCTTAGTGG
ACGTCGGATTATTCTACGCACTGCGATTGCATCTGCTTCTCGGTTGCAATCTCGTCACTTTCGTGAAGTGCGTTCAGTCAGTATAGCAAAGCGCTGgTGC
TATTTCGCCCAGGGATTGATGgaGGCAGACAAAAGgcAaGAAGCATCGGACAAGTCTTGCGAGTATCGCAGAGCAACTGCACAGCAAGATTAAGCGCATT
CGGGACCAAaaGGATCTGCACGCGATCGTGCACAAATGGCAGCTCCTGCGATGGCGAATACTCTgTCGTGAATATGTCCACAGACAGCGACAGCATCTGA
TGgTAGGGCTCCGACTCATGACTCAACTCGAACGTTtCcGACGAGCCGCCTTATCGCAACCTGCGtCACACGTTGAGCCATCGAAGGATGCGGCGCTGGC
ACTGAATGACGCTGTGCGAGAGTGCGTCGTCATGCTTCGAAGGTGCTGTATCGAACAGACAGAcATCACGCGACGGATACAGCATCAGCAGTCACTACTG
GCGGATGGAGCgTCGTCGTCAGCTCTCTCGGACTCCTGTGAGTCTGTGGACGCGCaCgTTTTGATTGAGCTCCTTCTCGAGTGTAGTGAGCAGCTAATTC
ActGGAAAGAGACtaTTGATACGAGGCTCCGCGAGATCAGCGTGCGTGAAAGCcAGCtCAACCGACTCGAGATGCACTGCTCGGAGCTACAGGTACTAGT
GGACAAGTACGAAAaGCGCCATACTGAAACGGAGCGGCGTGCCATGGAGAGTAAAGCACTTGCCAAATTCAAGCGTGAACGGCGgcAATGGAATGAACGC
AATATTCAAATACTTGAAGGAGTGATTTCTGAACTCCAGAAGGCAAAGCAAGTGAGAGCTGcGTTGCACGAGCGCCTAGAGCGTCGGACGCGGTCGCTAC
GTCAAGCAGAACGCcGTTGCCAAGCTCTCACATTCGAACAAATCGTATTTCGAGCaTTTTATCACTGGCGATTATTCACACTCAGCAAGAGCGACATGGC
GTCACCGAGTTGTtATACTGAACACGAGACTCACCATGAGCATGATCAAACAAGTACTCAACCGGTCATTCCAAGCTTACCATAGTCCAttGTGATACGG
TCAGCACAGTGCTTCCGCTGTTTCTTCGCCTCTACAGAGCTGCTGTCGTCGTCGATTTTGTCCTGCAGGATCTCCTCCACGATATCTTCGAGCGTGACCA
TCCCTTTGAGCTCGTAGAAGGGATCTCCCTGTCATCGCACACATGAGTTCGTTCCCCACCATCACCATCGCTTGTGCGCCAGGACgTACCGGCCCAGTGT
TATTCACATCATACACGAGCGCCATGTGGGTGCTGCCGACCTTGAAGGCCTTGAGGACTTCTCCAAGTGTCGCATCAGCCCACACGCGATGCGCAGCTCG
ACCGAAGACCTGCACAAAGTTGGCGAGCGGCACATTCCCTTCTTTTGGGTCAATCAGTACGAGGTCTTTCACGAAGAAGACGCCGATGATGTCGTCGGGA
TTTTTATCCCACACGGGGATGCGACTGAAACCTGTCTCGTAGATCGCCTTGACAGTGTCCATGTCGAGAATCGTACTGGCGTGAAGCACCAAGAGCAcGA
AAAAGGTTAAGGAAGCGTtCAAGACTCACCGCTCAAGCACAATCATCATAGTTCAGGTAAGAGGATATCGGAAGCGAGTAGATGCGGTCGAGTTCCACCA
TGATACTCGTCACGCGCTTTTGTCGGTAGCTCATGGCTCCGCGTACGATGTGGCCTTCATtGGGgTGGAtCATTTGCTGTTTGACGTGGATCTCGAGGAG
TTTTTGTAACTCGCGCTTGCTGAAGATAGTACCGACGTctGCGCCTAGGGCGTAGTCGAGAGCCATTGAGATGGGTTTCGCGAACACGTAGAATGCCGAA
AGGATGACCTTAACCACTGGGACGAGAGCTGCGCCGACGCGTAATGCATGGCGAGAGAACACAGCTTGTGGGATGATTTCGCCAACAATGACGATGAGTA
CTGTGGAGATGAGGAAGCCGGCGAGCCCGCTTGTGAGGTCCGCCATGAGGATAGAGAGGAGACTGTTGACGGCGATGTTACCCAGCACAAGCGTTGTCAG
CAGTCGATTGCCGTTTTCTCGCACGGGCGCGATTCGCCTTGCCCATGCAGCGTTCTGAATCTCCTCTTCGCTAGCATCGGGCGCCTCTCCAGCTCCtGCC
GTGACTTCGAGGCCAGTTTTGTCGAGAGCCATGAGACCCAGCGTGAGACCAGAGAAGATTGAGGACATCCCTACAAGTGCGAGAATGCCCATGAAGCGGA
AGATCTCGATGACCATGGAGGGCGATTCtCcATGGTCGTTGTTGTCATCACTGGTCGATGACTCGGCGTGGGGTGGCCCATGTACAGCCAGTaCAGTAGA
TACGACACCTGCAAGAAGCGCCCATCGAAGCCATACGCGCATCCGCGTAGCCATCATTGGAaGgATCGAGgTTGAAGtACCTTCAGATGTGCTGCATACA
AGTCCTgaaCGATAATAGCGACTTTCTGCACCTGAAACGCTATCGTGTCTGTTGCAGAGCCTGTTATGCGATGGTGTCCGCTCACGGAAATGAATCGTCC
CATTCTAGTTCCTAtCggCTACAAGTGTTGTGACTGCGCcACCAGCGACTTGGCGTACATCAAGAACGCGCGGTTCTCTCGTGGTGACGCTGCCTGTTGG
TTCCGGCTccttCCTaaCGACGCGTATCGAGCAAGCTCGTCAAATCGTTCCATCAGTCCGTCAATCTCTCCAGcGGCACCTGAAgAaGACGCCGGCGGGC
CAGTCACAGCACTgCTCGAGTCAGAaaGAaGAGCTCCTGTTGATGAAGAAGACGACAGTTCTCGCACTGCTCGTGCCCCCTTGATCCCAGAGCCACAGGA
CGTAGTTCCAGTCGGTGCTAAGTTATTCTTCAGCTGTTCACCCAGGCGACAaTCGTGCTCGAAAGCGTGCAGTCGCTCGACGTATTTAaGGCGAAGATGC
TCGGGTACGGcTTTGCtGGTAGCTCTCGTTTTCAGCAGCAGAGCCATGTAAAAGTACGcGGAGGCCCGTACGCTGACGCCAGGGAACTTGAGGCGCGCGT
TGCCCAATAATAATAGCGTTTCATTGAGCACGCCTGAGAGCTCCTGTTCGATCCGCCCTGGGCAGTTCTTACTGGCGAGCGACGTCGCCAGTTGCGGTGG
CAACTTGATGGGCAGGAGCTGGAATGCGAACTGGCGAGGATTGTTGaTAAACTCACGCTTGGCCTGCTCCGAGACGCAGAAGAACACCTTGTTCTCGTAC
GAGACACGATAGAAGACGGAGCCCTTCACgaTGGCCTGCCAGTCTTtGTCGCCCGTGCCGTGCTGGAATGTGACGGGGCAATACCCTTTCATTTCGGGGA
ACTCGCAGTCAGGAACAGACATGAGTGAGAGCAAAGATGCATCCACCGGAACCTTGGAGATGAGACTTTCTGCTGTCGACACTGAGTCTTCGTCCAGGTA
TCGCTGTGGGTCGCTTAGGAATTCGAGGACGTTGCATTCGGTCGCAAACCACAGTGCTgTACCCTTATACTCGACGCAAAGCGGTCGTTGCTCCGGTAGA
GACGTGTGGTATCGACCGGCCGCAAGCTCAACGGGGCAAAACGACTGGAGCACCGGATGAGCTTGCTGTTTGAGGTCGTCAATAGAGCGCAAGACACCAC
AGAGTCTCGTAGCTCGTCCCATGGTTGTGTCTGCTATGTACTTCCGAGCGCACGTCAAGTACTCGTCCACGACGGCACTAGCatGCGCAGTGGCTTGCCA
GGCAGAGTGCGAATCGGCGTCGATTTGACGCACgTGgAAGGGCCCAAAGGTAGAATGCCAGCGATGAAGgAacTCCAGaCGATGGCTTTGCCAGGCGCTG
AACGCTTTCATCAAGccTTCCTttAGTACCTCGAGATCACTATCGGAGGCACTCGGTCGTACCCGGTACCAGGCAGACTtAAATGAGCCTTGAAGCACGA
AGGCAATCGCTGGATGGATCGccgccACACCATAGAGGCAACGTGAAAGCTCTTCGGCGGAGAGTAGGTATCCGTCGAGCACCCAGCCGTGCTGTTGGCA
GTCCGATGATCGCAGACGCGTGGTAaTAGCTGCATGAACCAGCTTCCGGTCAGACAACCAGGCTCTCTGGGTCCCCGCTCGCTGTGCTGCTTGGAgcTTG
GCGAAGAGTGActCGTGCGGGCCTAGGCACTGTAATACCCAGTCGATAGCAGTCAGCGGAGAGACGTAAACGAGGCTGTAGCGTTGAGCAAGATCACGTG
CCAGCCGtGTTTTTCCAGAGCCAGGCGAGCCAACGACACAACAAGATACGCGGCAATGTGGAGGCTGAGAAGCGCGAGtGAGCATCgaTTGTGACGGATC
tGCTTCACACTGTGTCACCACATCGAATGAGCcTGGGAAGTACACACGTCCACGGTaCAAAaGTGCGGGTCGTGGAGGTCCGTCGCTGAAcgggATGCCA
GTGATCGGGCACAGTGAGCCATGCTTCCCCACTATCGCCTGGCCAGACtGCAGtACGCGTTtGACGCGTGTGAGGCTCAGTCGCACGCaGTATTCGAGCA
ACGCGTtCTTTCGGCGAAGCAGACtCTCCACTACTGTgCAGAGCTGTTTGGTGACAGCTCGTTGCGTCCCTTCAACGTTGACGGGCTTTGCGACCTCGAG
GCCACGTTCGCGAATGACGTCAAGGGCAGCGgCTAGTGCTTCTGCATCTGCTTGGTATTGTTCCTGGAGTCGAGTTGTCTCTGCTGTCTCTTTCTCCATC
GGGTCCTCTTCCGctAGTGTTTTCCTtctCGCCATTGTCGCCATCagTCGGAAgCTTGAGCCGTGGTCTCCGAGGTGGTAATGCACCTCGCCATTGCGTC
AGTTGTCTCTcGACAAGTCCAGCCTCGTCGCCTTTGAGAGGCAGCACGAGTGTTGGAAAGAGATCCTTcGAGAACAAGTCGgTCAGTAGCTCAGGTGTTG
GAAGAGGAGACGTCGCTGCGGCTGGCTCGCTTTGCTCTTCTCCTATTTGCGAAGGGGTTGTGATGCCCCAACTACTGACGTTGCTGACTAGTATCGCGTG
CCATTGCCTCGATGTCTGCATCTCGTATAGCTCCTTCGCGAACGCGGCCGCGTATAGTTGACTGAGAGAAGTTTGTTTGCcGATGGGTAGTAGTAACTGC
AaCTGGAGCTGGCGCTGCACTTTGGAAGCAATGCAGTCGTTGTCCAATACGCCGATGCGACTGTCTACGACTGACGCCACAACACCTCTAGCGAGTTGGG
CGGCGTTCGTTCCTCGGACGCCAAGTAGCCACACAACAGGCACGAGTGACTGGGTCgCGCACGGCTGAGCAGGTATATAGGCCAGCGGATTCCGcTCGAA
TGACTTGAGTTCTCTCGCTCCCGcACATGCATAGAGCCTCTGGCGGAACGACACAGTAAACGCGGGCAATCCGGGCACTAGTACTCTCTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACACGGGGCaGaagTGTGCCGTcTCGCCcATaCGAAGACGCTTCTCC
AGacGACGTCGCTtcATTGCACTATACCGAAGCATCGCTCGTTCACGTTCCTGGTCTTCCCTCTTAGTTTtCGTCTCTTCATCGTCATCCTCTGCTGGTt
cAACGAGCTCTTCTTCGACTGTCTCGGGCACTGGGgCGAAGACGCGAGATCTCTCGTCTTCAGCTTCTGCCTCAGCCTTCCACGTTCcATCTTCTGATGT
GTCGACTCGAGGCTCGAGTGGAGATAGAAGGCGTCGTAAGGCAGCTTGTGTCTCTTCTGGATCAGCAAACCACGGGCAGCGCTTCACCATGGGGGTTATA
GGAAGCGACTCGCTTAGTATTtCAGTCAGGGACGTCAAGCTCGCGTCACCACCAGCGGCGTCATACTGAGCAGCCCATTGTTCGTGTTTCTTCTTCTGTA
GGGGTGTCGTGCACAGTAGAGACAGCTCTTCTTCGCCCACTGACAGTACGACCACTGtATCTGGGATACAGCTACCTTCCGCCAGCACTGCCAACACTTC
TTTtGtCGgTGgCAGATCGCTTAGAACCCACGCGTCTTTCtCCTTTGCAGCGTCGATCAcGAGtgCCGCCACTGCACTCGCACTCAGGGCTTTGCCCTCC
ATCAGCTCCATCTCTTGACGAAGCGAGTGCGTGGACCCAAGCAGCGTTGTGGCACTGATACATTCACCTTGTACGACACTCGCCAATGCTATGGCTGTGG
AAagATCCAAGGGTtGGCTCGCCAGTATCCACAGCTTTTTCTGTTGATACTTTGGTGGCTCTTGCCTCAAGAACTGCGgCGGAGCAGAGCAAAACTGGTC
GCGCGCTTCAGCGGATGAAAACaCGTAGATGAAGCCACTGAAGTAGAGTGCAAACTGTGGGTCCCCCTGACTGGAGTGACCACCTGCAGCCgTCACAGGA
CAGCAGTCGCGCCACCGTGAGAGACACCGAGGCCATCGAGGGTCTTCTGGAACACATGCAAACGGAGAAGGCAGTGCTGACGCCAAATACTCGGTCCAAT
CTCCATACAGgaGCCAacGCAGCTGGTCGGCGCGACTTCCGCCGGCAACATgcTCAGGTAGGCTCACTTTCAGCGGTGACCGTGATATCGCAGAACGTGT
TAGTGCCATCACGTCCTATtCATCCATGTCCACTCAGTTGATGCCCACCTCACGCCTCATACAATAAGGTTCTACGTACGTTTGTTATCGCGACGACgCA
CTGGGTcaCGACGTCACTTAGTGCTTGAGCGCCCAGGACGCGAATGACGGTAGTGCGGGCGGAAACTGATGCCAAACTCGCATCACGGAACTCGTAGTcT
CGAAAGCGGTCGCTGtaaGTGTCTCGTAGCAGCGATCGAAGTGGAACCaTCGGCTCTTCAGGCGGCTCGATCTCGTTTCGCTGCACAGTACTTATTGGAC
TCAACTTCTCTtCGGTCGAGGGTTGCTCCTCCCCAGCGCTCTCgTGAACGGGAGCCTGATCGGTGCTGtCAGTAGCTGGgCTTTCTCCGTCTTCATCTtC
TtCTCCACCCTcTTCGTTCTGCTtCGaGgTGGGGgCAGTAAAGGTGGCGAGGGCGgTGGcGACtGCTTCTGCTACCCGCGCTTtCCTCAAGCCGGCATCA
CTCTCCCCGTGgCTCGACGgTGTTTCGAaCcGCATGACGTAGGTGCTTCCGTCGCCAAaGCCCTTCTCTCTCAGAACTTCATCACTCTCGaTTAGCATCG
CtCTCTCTCGGGCTGAGTAGACTCTACGCGTCATTGGGGCGATtGTCAGTCCGCTGATGTGCTGTTGCGCGTCTTCTCTCGCCATCTCCAGTGCGACTAC
GAAGTCGATGGTGATTGCGCaGTTCAGTtCGAAAGGAAACACGTCgTCAAGCACAACTCCGATACCTCGCAGCAGTAACGAGCGCACATACACCACGACC
AACGGCAGCGCTCGCTCTCGAGGCAGAGCCTCTCCAcTCTGGAgTGCTGCCAAGTCAGCATCTCCGAACAGCAAATCCGCTTCCTCGACCTCTTCTTcTT
CGGCATCGACATGAGTTTCAGTGGCGGAGAGGTCAATCTCCCAGGACGGTGGGTCGCTCGCCTTGgTCTCGgTTtCctCTCCTGCTTCCTGAGCCCTCGt
ACTtGCTGCCTCTCTGGCTGCTTCTGCGGCTTGtcTCGCAGCcTCCcTCTTAGCCTCTCGTCTCTCTTCCCGTcTtGtATCCCTTGCCTTCTTATTTACG
ATCGCGTCCTCGATAGCCATTCCGACCGAGACATACTGCAGTTCGAGCCTTTTCGCAAGGCTAGTGGCCACTCTGGTCTTCCCAATGCCTGGAGGTCCCA
CGACTGCCACACGTAGCGCCGGAAACGCCTCGATAGACTGCACGACAGCATCTTCAGGATCAAATGGGTCATTGCTTTCGAGACTCGCGAGTCGAGATGG
CCCCATCGGTGACGTCAGCGTTGCGTCTCCGGTCACAGGCCaTTtCGCCGCCTCCATCTTCGCTTGGGCTCCTTCACCAGCAAAGAGCGACGAGAACTTG
CGTGAAAGCGAGAACTTTCGAGGATTATAGCTCAACAGGAGCTgTTTGAGCGACATGCTTTCCGTCTCGGGTGGCAGAAGACCTCGGATCACGGCCAagT
GGTCGGCGTTCGGTGGGCTCTTCTGGAGGAACGCGCCTCGGATCTTGACGACTTCACGTAATGGACGGAGCGTGAAGGATGCGTCGGgTGTTGGATGGGC
TATGGCTTCTCTTAGCTCGAGAAAAAAGGaGGCGAACATCGATGCATCGCTCTCGACTGGCAaCACGATCTCGGCGACTTGTAACAAGGCCTCTTTGAAC
TGCTCAAGTGTGAGTCTCGCTGATGTGGTGTCGTAGCTGCCAGCACAGTCGTAcaCCCAATCTCGAGTcGCGATTGCTGGGGCATGGTCATTGCCGACGC
TCTGAACCAGAGCCTTAGCAACGGATTGGAAGAGCGTcACGTACGCTTTCTTGTCCAGTGAGATCTCGTGCGTGGGCTTGGCCAAGTCGAAGAAGAAGGT
TAAAAACCGTGTGAGAGACTCTTCGGAGTGCAGGAAGTACTGTCGTCGCGCGAGCCACAGGCGCAGTACGTTGCTTTTACCAgtCTGGTCGCCAACACTG
TTTTCATTCTCTTGCTCTGCGTAGACAAAGTGACGCCGCAGTTCGCGCATCGTGCCGTCGAGCGATTGACAGACACTGTGTGAGAAGTCACGAGGCTCTT
CGTAGGAAACGAGAAGCagaaGGCACAAAGACGGCATATATATAGCGGAGGGACGCATTCATTCAAcGCTTCATAGAGCCACGGGGCCAACACCACTGAC
ATTGAGGAGCTACATAAGGATTAGATAATGTGGTGGGAAGTTAAGACGCCCTATGGATGCAAGGGTCGTGAGGaGGAATCGCTGATGGGCGGATGAGGAC
GCGTGTGGCTTCGAGAGAGATCTCGGTGCTT