Description :
From Genome Similarity Track
Location :
Scaffold_1684:2- 1447
Transcript NameFunction/comments
Physo_145555hypothetical protein

Sequence
1445 bases(100 bases per row)
CGACGAGTTCGTGTGCTCCATCGGCTTCCAGTGTCGGCCTTCGATCCGTGCCTCTACATTAAGGTGGTGGACGGTCACTGCGTGCTTGTACTGGTGTACG
TGGATGACGTACTGATTACCAGGAGTTCGCCCGAGCTGATCGCACGCACGAAGACCGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGC
GTTTGTTCTTGGGATCGAGTTGGTGGACGGCCCGGACGGCAGCGTGGCCATGTGCCAGCGGCGATACGTGGACGACATCCTGAAGCGCTTCGCCATGGAC
GAGTGCAAGGCCGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTG
CTCTGATGCACCTGATGACCGCCACGCGCCCAGACATCGCGTACGCCGTTGGCTATGTATCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGC
GGTCAAGCGTATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGGATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCGGAC
TGGGCCGGCGACCTCGCCGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAATCAAGTGTGT
CGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATTCATCGCCTGCTATGCGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN