Description :
From Genome Similarity Track
Location :
Scaffold_921:2- 1437
Sequence
1435 bases(100 bases per row)
TCCTTAGCAGCGCTAACTGGTTCGCTAGCTCGCGGTCGTCCAGGGTTTCGATGAAGTGATCGACATGTTCACGGCGGACTTCGATCGACCCATCCTTGAT
CAGCAAGTGGGCTCTGAGGCCAGCGACATTTAGGCGATGCAAGTATTCCAACGGCGATTCTTCCGAGCGCTTCCGAGCGTGGTAGTACTGTCTCGCGACG
GATACTCCTCGGCCACAATACTGCGTTTGGAAGGTCTGGGACAGACTCTTCCAGTTGCTTCTCGTGGTTCTGCTCAGTTGGCGGTACCAGTTACGCGCCG
GTCCGGTGAGCAGGTCTCCGAACACCAAACACTTCTCGCTGTCGGGAGCCTGGTCACGGATGAAGGCTGATTTCATCTTGCTGAACCAGCTTCTGGCACG
ATCCTCATCGCGGTCTTTGCCGGAGAACTCCTTCAGTTCTGAGATCGCGGAGACTCTGATCCGCGTGGCCGAGAACGATCCATTCCCCGAAGTTTCGGCG
GACGCAACTGCTGCTCGAGTGGGTACTCCAACGCTCAGATTATCCGGATCGTATTCGCTTGGGTGCGAATGCTCTGGGTGGTTTGATCCAACTGATTCCA
TCTCGACATCTTGGACGATAGGCGTTTGGGTCCGATCGGCCACTGGGCGATCAAGGACCGTACGACTCGATACTTGCGGCGCTGTCGACGCTTGCTGTTG
TTCCTTCAGGAAACGTTCCATCGCTGAGTTGAAGAAGGTTTGCATGCGGTCGGGCGTGCTTCGACTTTGAGCCGGTCTGTTCTCGATCGACGGCTCGATT
ACCGGTGCGTCCATACGCGATCGCAACATGGCTGCTCCGGATGGTCCGAGCGACATGCGCTGCGGCTCGACTGAGCTGTCAGAGCCTGCTTCCGACGTGG
CGGAGGCATAGTGCGACGAGCCCGTCTGGCTGCGAGTCGTAGGCGATGTTGATCGCTGTATTGGGACGATGCTACCGACGATCGGTGTCAGCTTGGCGAA
CAAGGTCAGAGTGGATTCTCTGATCGCCTCCGGTTTCAGATCAAACAGATCGTTTGCATCAAACGCGCCAAGAACAATTCCTGCTTCTCTCAGCATACGC
ATCAGGAGTTTCGTGGCGTCCAGCATGTTAGACACTTCTCTGGGCGCCTTCGCTGGACCTTGTAGGTCCCCAATCAGTTTCGGGCGCATGATCTTCATCA
CCCGGTCTTCGGCCAAGAACTTGTATAAGTCCTTCCGGTAAAATGCAGACTCCAATTGTTCCTCCGTCCACATCTTGCGATCTTCCGGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN