Description :
From Genome Similarity Track
Location :
Scaffold_3122:2- 1423
Sequence
1421 bases(100 bases per row)
TCTGTAACACATCAAGGTGACAGTGTTCATGGACGCCGTGTGAGCCCTGCTCGCACGCAGTTATTCCGCTGGCAAGTCAGAACGCTGGAAGAGGCGATTC
AGATCGCCCTTCAGGAGGAATACAGCCACAAGCATGATCGCATCCCCACCACGGCGTAGTACGGCCACGCAGACCCGAGCAGTAGCCCCGCCAGGGGCGC
TCCTAGTGGTCCAGTGCCGATGGACCTGAGCTTGGCCGAGCATAGCAATATTCGCTGCTATGGCTGCGGCANCTTGAGGAAATATCCCTCCAAGCCCTTT
GCTATGAAGGGGAGCTGGCAGAAGCCGCGACCAGGGGGCCAGGGAACGCGGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGATCTAAGTCTTCAT
GAGCGGTGCACGGTAGCGCGCACCATGAAGACTTAGCCCTGATAGTCTCTGTACTCTCGAACAGAAGAACAGCAGCTGTGGGCTGCTAGTAGTACACGCA
GGTATACGGGGATACGATCATCCTTTCCGAGTTTTGATCGACTCTGGGGCGTCGAAGAACTTTGCATACCGTCAGACAGTCGCGGGCAATAGCGACAGGT
TTGTCGATGTTCTGCGCGAGAGTAAAGGCAAAGGGCTGGTCTCCGTGAGACTGGCCGATGGTACAGTGGTGGAAGTACCGAAGGTCCACATAGATCTGGC
TTTCAAGTGTCGGCCTTTGACAGCACAGAGCAATTCCTCGCTCTANAGATCTGGCTGTCAAGTTCGAGGACTTTGACAGCACAGAGCAATTCCTCGCTCT
ATGTATGGACATGTATGACTTGATCCTGGGCATGCCGTGGCTCGAGAAACACGAGCCCTGGATTGACTGGCAAGACAAGGCCATCGACGCCAGCCGACCC
GCAGTTTCTGACAGAGCATTGGTATGTCGTATTTCCACCTCTGCCAGAAACAAGGGCGCCTGGAAGGCACGCCGAGACACGAACGCGTCTGAAGAGCTTA
TGGGAGCCGCTCAGGTATTCGGCAGGCTCcctgaagaaggtgctgagTCAGCACCTTCCGACGTAATACGTCGTGAGGTCGTGAAGACCACTACgccggt
ggcgctggatAGTGCTAACCGGATGGGCAACACAGTTCCATCAGTGGGTAACATGGTTCCGCATCCAGCAGGAAACGCTGAGGAGGTCGCTAGAGGCGCC
TCTAGTGTGGGTAACATAGTTCCACACGGGGTCGGTAAGACCTCTGATGCCGCCGTTGAAGCATCACCAGACGTGGGTAAAATAGTACCACGTTCCAGTC
GTCGGCGTAAACGACACCGACATCGCCAAACTTTGGGTCTGGGGCCACGTCAGACCGGAGTCGCCTCAAGCGACTCCGAGCCGAAAACCAAGGCTCTGTA
GACAAGGCCCGTCGAAGAGCG