Description :
From Genome Similarity Track
Location :
Scaffold_3715:2- 1413
Transcript NameFunction/comments
Phypl_g15991putative polyprotein
Phypl_g15992reverse transcriptase putative

Sequence
1411 bases(100 bases per row)
TTGCGTCAGTGGCTGGGCTTGGCTAACTACCTGCACAAGTACACGAAAGATTACGCCGGATCGATCCAGCCGCTAtcttcgctgctgaagaaagaCGCCA
CATGGCCGTGGCGTCCTGAACACCAAGCCGCCTTCGACTCGGTGAAGAGGAGCCTGGCTTCGGCGCCGATCCTGGTGCTGCCAGACGACTCGAAGCCATT
CCACGTCGtctgcgacgccagcgacttCGCAATCAGCTGCGCGCTaatgcagctcgacgacgagggtcGCGAACGGATCGTGAGCTACCAGTCACGATAG
CTGAAGCCCGCAGAGCGAAACTACCCGGTCCACGAAAAGGAACTTCTTGCGATGCGCTACGCTCTGATCAANCGAGCAGACATTTGCCGTGTACACCGAT
CACGCATCGCTACATacagcgatgaagagccCCCACTTATCGCAACGCATGGCACGGTGgctctccttcttctccgagtACAACTTCGTCGTCCACTACA
AGCCGGGCAAGAACAACATTCTCGCCGACGCTTTGTCCCGGCGCCCGGATTACGATCCCCGTGCGGTGCTGGGTCGTCAGactgctgacgacgacgatga
cgaagatgactGCGCGATGTGCATCGTGTCAGGCTTGAACCTGACGAGTGTCAGTCCCGAGATGCCGCTGCACGCCGAGATCGCAGCAGCGTATGAGTAC
GACTCCGTGTACAGCGACATCGTCGCGTACTTGCTCGCTCCCAGCGACATTGTACTGGGAGATCTCTCGCGCACCAAGCGCGGCCAGATCGACTGATACC
GCCTTGATGGAGATATGCTGACGTACAGCATCGATCGCTTCGATGCGCCTCGGGTGGTAATTCCAAATGACGCCGACTTGCGAGCTCGGGTCATCCACGA
GTTCCACGATGTCCCCGCTGGCGCCGCGAAAAGACTTTCGCAACGGTGTCGCGCGACTTCTACTGGCCTTACATGTACAAGTGGGTGCGGAACTGGGTCC
GCACCTGTGAGACCTGTCAGCGGGTGAAGCCTTCTCTGTCGTCGCAGGCCCCCCTGCGACCTCTTCCTGTAGCTACCGAGGCGTGGCGTTCGGTGTCGAT
GGACTTCATCTTCGGACTCTCGCCCGATGAGCAAGACCGGACTGGTGTCTTGGTCTTCGTCGCCAGATTCAGCAAGATGGTTCATCTCATTCCGGTGGCT
GACTCGGTCACCGCGGCTGACACCGCGATGCATTTCGTCGACGAAGTGTTCCGTCACCATGGCCTGCCCGAGTCCATTGTCTCGGACCGTGATCTGCGCT
TCACTTCGGCTTTCTGGTCGAAGCTGTTTGAGCTTCTGGGTACGAAGCTCCTGATGTCGACCGCGGCTCATCCGGAGACGGATGGACAAACCGAGCGCGT
GAATCGGGTCC