Description :
From Genome Similarity Track
Location :
Scaffold_3514:2- 1406
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3514-fgenesh-gene-0.0Endo-beta-1,6-galactanase

Sequence
1404 bases(100 bases per row)
GATGAAGGTGTACATCACTACCGCTACGATCGCGGCGCTCGCTGCCCTGCAACTCAACCCTGTCGCTGCCGACTACAGCGTCAGTGTCAAGGGCAAGGAC
GCCCCGCTCGCTGACTGGGAAGGCTGGGGCACCTCGCTCTGCTGGTTCGCCAATGTCTTTGGTGACCGTGCCGACGTCGCGGATTTGCTGTTCACGAATG
CCAGCTCCGTCAGTCTCGCCAACACTGGCGTCACGGATGTGCCTGGGCTCGGTCTCAACATCGCGCGCTACAACATCGGCGGCACAGGCAACAACGTCAT
CAACGACAATGGAAAAACCGTTAGTATGAAGGTATCAAGTGAGATGCCGGCGTTCAAAGCGATCGAGACCTTCTGGCTTGACTGGTTCAACTCCGACCCA
ACGTCAACGAGCTGGAAATGGAACGTCGACAACAAGCAGCGCGCCTTGCTACTCGCGGCGAAAGCACGCGGCGCCAACCAGCTCGAGGCCTTCTCCAACT
CGCCTCCATGGTGGATGACCGTCAACCACGCCACCGCCGGCGCTGACAAGAAGGGCACCATCGACAACCTCACCAGCTGGAACCACGAGCAGTTCGCCAT
CTACCTCGCCACCGTCGTCAAGTACGCCAAGGACAACTGGGGGGTCAACTTCAACTACGTTCAGCCGTTCAACGAGCCCATGGCGAACTGGTGGGTCTTC
CCGAAGAACCAGGAAGGCTGCCATTTCACGCTCGCAACCCAGAAGAGCGTGCTCAAATACCTGCGCGCGCAGCTGAACGCCAAGGGCCTGCAGTCCGTCG
GCGTCTCTTCTTCCGACGAGAACAACCCGCAGCAGACGTACGACACGCTGCAGACCCTGGCAGCTGATGCAGCTGTACTCAGCTCGTTCCAGAAAGTTAA
CACGCACGGCTACGACGGTGGCGTGGGGCCATACCGAGGTACGATCCGAGGACCGCTCAAGACGCTCGTGCAGCAGAAAGGAAAGAAGCTCTGGGACTCC
GAATACGGCGAGGCCGACGGCTCCGGACTCAGTCTCGCCGAGTCCATTGCGCTCGACATCAACGACACCGGCGTCTCCGCCTTCGTCTACTGGCAGGCGC
TCGACAGCGGCGGCTGGGGACTCGTGCAGTCCAACCCGGGCGACGTCTGGATCGGAGGCGCCAACCCGAAGTACTACGTCATGGCGCAGTATTCGCGCCA
CATTCGATCCGGCATGAAGATCATCAGCTCCGGCGGCGACAAGAAGACTGTCGTGGCCTTCGACGCTGCGCGCAAGGTGCTCGTCATCGTGACGGTGAAC
ACGGGTGCTGCGCAGTCGATCACCTTCGACTTGTCCTCGTACGCGAGCGTAACGGGACCTGTGACTGTGTGGAAGACCGAGACAAGCGGCTCAGGGGCTC
TGTA