Description :
From Genome Similarity Track
Location :
Scaffold_3213:2- 1401
Sequence
1399 bases(100 bases per row)
GCCCTTGTGAAGTTCCGTGCTCACCTTCTGGGCGCTAGACCCTTTGTGATCTACACAGCCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTC
CCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACATGCTTGCGGACGCCCTCTCTCGG
CGTCTTGACTATGCGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCG
TCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGAGCCTCCTCTA
TTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGC
GGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTTTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTTGCCCGGTACATCAAGCCATGTGAAA
CATGTCAGCGGGTCAAACCCGCAGGGCACTCGTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGCCTTGACTTCATCTT
TGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTCCATCTTGCTCCAGTTCCCGTCACTGTGACG
GGCGAACAAACCGCAAGGTTGTTTGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGT
TTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCGGATGTCCACTGCGGACCATACGCAGACCGACGAACAAACAGAGCGCGTCAATCGGGTGCT
CGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCC
ACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTTGAAAAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGG
CTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCATATTCGCTGAGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAG
GGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGAACTCGT