Description :
From Genome Similarity Track
Location :
Scaffold_3744:2- 1384
Transcript NameFunction/comments
Phypl_g16008hypothetical protein

Sequence
1382 bases(100 bases per row)
ATGCGTCTTCTGCGCGCCCGAGATTCCGGTACTCGGGTGCTACGTAAGCAAGGACGGCGTCCGCGCTGATCCAGAGAAGATCACATCGATATGTTCTTGG
CCAACGCCCACGAACCCCACGGAGTTGCGCCAGTGGCTGGGTCTCGCGAATTACCTCCACAAGTATACGAAGAATTACGCCTGACTGATccagccgctgt
cgtcgctgctgaagaaagaCACCACGTGGTCGTGACGTCCAGAGCACCAGTTAGCCTTCGACTCTgtgaagaagagcttgtCGGAGGCCCCGATCCTGAT
GCTTCCGAACGACTCAAATCCGTTTCACGTGGTCTGCGACGCGAACGCGCCGTGAGCTACCAGTCACGACAAATGAAGCTGGCTGAGAAGAATTACCCAG
TCCACGACAAAGAGCTTCTCGCGATGCGCTACGGGCTGATCAAATTCAGTGTACCCTGCTCGGGGAGCAGCTGTTCGCCATCTACACGGATCATGCCTCG
CTGCGTACTGCGATCAAGGGTCCGCATATCTCGCAGCGCATGGCCCGCTGGCTGTTTTTCTTCGCCGAGTACAACTTCGTTGTGCATTACAAGCCCGGCA
AGAATAACATCCTTGCTGACGCGCTGTCACGCCGCCCAGATTATGATCCGAGACCGAGATATTGGAAATCAGGCATCTGATGTCGATGACAGGACGACGA
ATGTGCTTGCTGTGTTGAGCTTGACGGCTCACTTCTGACGTACACGATGGACACCTTCGACTCACCGCGCGTCGTCATCCCAGCCGATGACGACCTCCGT
GCCCGCCTGGTCCATGAATACCATGACGCCCGCGTCGGTGGTCATCTCGGTCGCGAGAAGACGTTCGCTGCGCTATCCCGCGACTTCTTCAGGCCTCACA
TGTACAAGTGGATTTGAAAGTGGGTTCGATCCTGCGAGACTTGCCAACGCGTCAAGCCCTTGCCCTCGTCGCAGACTCCGCTACATCCGTTGCCGATTGC
TACGGACACGTGACGTTCATGGACTTCATATTCGGGCTTCCTCCAGATGGCCAGGGCCGCACGggtgtcctcgtcctcgtcgatcgCTTTAGCAAGATGG
TCCATCTTGCTCCAGTCGCCACTCAAGTCACAGCGGAAGACACGGCTAGCCTGTTCCTCGATCTGATATTCCGGCGCTACCGCCTGCCGGAATCCATCGT
GTCCGACCGCGACCCGCGCTTTACGTCAGCATTCTGGGATCTCCTCTTCAAGCTTCTTGGCACGCGCGTGAGCCGCGTTCTGGAAGACGTCCTTCGCAGA
TACGCCACGTCGTTCTCTTCGTGGAGTTCCTTCCTGCCGCTTGCCGAATTCGCCATCAACAATGCCGTCCACGCGTCAACCG