Description :
From Genome Similarity Track
Location :
Scaffold_2280:2- 1369
Transcript NameFunction/comments
Phymu_g14014hypothetical protein

Sequence
1367 bases(100 bases per row)
GGGAACGGCAAGTTGCACAGGGCTTCCACGTCCTTGGGCCGCGCCTCAAGTCCTTCGATCGAGACCCGGTGACCAAGGTAATCCACCTTGCGCAGGCCCC
ACGATCTCTTCACAACACTGATGGGCAAATTCCAGCTGTCACAGGCGTTGAGCAGGTCCTCGACTTTCTCGCATAGGTGATCCCAAGAGTCAGCGGTGAC
CAGGATATCGTCGATGTATGACCGTCTGCCAAGAACCGAAGGTTTGAAGTTGGTCTCTGGCTCACCGGTCTCGAAGACGTCAGCGTGATCCTCGGAGTCT
TCACCATTCCCGATCCGGAGGAACCCATACAAGGCAttgtccagcagccgctgATAGANAGATCATTGATCAGTGGCATCGGGTACACCATCAGTCGGGT
GAGGGAGTTCACCAGGCGGTAGTCGATACAGTGCCGGATGTccaccttgttcttcttgaagatgATCACAATTGGAGACGCCCAAGGTGAGGTGGATGAG
ACAACGATCTTCGCGGCTAGCAGGCCCTTAATAAGGTCGGAGAGTTTCTCGCGATACTGTGGAGCTACCCTGCGAACGCGTTGCGCGATCGGGGCGGCGC
CCCCAACATCAATGTCGCAAACGACTCCGACTGCAGCCGGTGGCAGGGCGTTCCCTTTCCCGATGAGAAGATGTTTCTTCTGCCAGATGAGATGTCGTAA
CCGATTGATCTCCTCCGGGGTATTCCACTGGGGATCACCCGCTTTGATATCTTCGATCCTGACTTCTTCGGCCGTGTTCACAATCTCAGGCAGGACGGCC
ATCTGTCCCTCAAGATCCTCCGCGACAAGACTGCCGTCATCGTGATAATACCCTTCGGCATCTTCCTGGATCTCAGCAGGTTTTTCCTCGACATGGATCT
tcggttcttcttggagttcTGCTgcgacttcgtcttcgaccGGAACAGgtgcttgttcttcttggtccaAGGTGAGGTCAGCCACTATGGGTTCGGCCCA
ACGGACCGTCGCAGCTGCGACTGTCGGTCGGGGGGGGGGCAGTTTCGTCTCTTCGCAAGATCTTGGTTGGGGGGTCGTACCGCGGATGTTCAACTAGCGG
TCCGAACGATTCAGGGGGCGGCACCTGTTGGTCTTGCCGGTCGGTAGTCGCTTCAAATGCGAGCGTCTGCCACTCTACATATCTGCGAGATCCAACTGAC
ACGTGACCTGGCACACGAGGAACAAGGTCTCCGGCGAGCCACATCCCCAGTTCGGTACTTCGCGACAAACGAAGTTCCTGATCACCAACGTTGGTGATCC
GCAGGAGTCGTCTCCGCCCCAGCCCCTTCACAATCGTAGGTACCCATCGTTCTCCACGCACTATCCA