Description :
From Genome Similarity Track
Location :
Scaffold_3247:2- 1352
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3247-fgenesh-gene-0.0Serine protease family S10

Sequence
1350 bases(100 bases per row)
ACTGTGGTGAGGATCATCTGTATACGCAATGAACATCTTGAGCCTACCTCTCAGAAGCTTAGCGACTGACGTTAGCTGACAACCTTTCGCATTGGACAGA
CAACTCGAAGAATACTTGATTTCTCATGTTATCCTGCGGCTCGACTTGGGAGTCAGAAGGGAGCCACATACCTCGCCGCCAACAGACACACCTACTGTAG
ATGGAAGCAGTATTGACGAAGTCTCGGTTGCGACATAAACTCAGCGACGCAGACTAGCTGCCGACTGTGATCTGTCGGAATGTTGAATTCCCAAGGACAC
TATTTTGCTGTATATGGAAGCTCAACAAATCGGTTGAGCATGAAAGAGAAGATGATTACGAAATCTACAGCAATCTGACTAGAGCTCCTGGTTCTTGAAG
AATTTGTTGATCATGTCGAGCGACGCTGCAGGCTGGTGCGCTGGCACCATGTGGCCGGCGTTGAAGACTTTGACCACCGCAAAATTTCCGAACGAGCGGA
TGCGTCCAGCATCCAGAGGTGAAGCGTTCGAGTCCAGAGGATCATTCGTGATGAACGAGCGCTGCTCCGCCGTGTTGAAGCTCGCCTTGCCGCTCCACTG
CAGAGCCGAGGTCCAGGCTTCGTTACCTTGCCAGTTGCACATGAGATCTGCGTCACCGGTGTAGATGAGTACGCGGAAGTCGGCGTCGAGCAGGTCCGCC
ACGTATTCTTCATAGTTTTCAGCGTAATCACCCGAAGTCCCTTCAAAGTTCAGGCTCGCTTCATCGCTGGCTTCAACCCACGTCGTGACTGGGCCATCCG
CAACGTTGAGGTATTCGCGCACGCTCTCCAGGTTGAAGAAGTCGCGGACGTAGTCCATCCCGTAGCAGATGCCGGTCGTGGGGGACTCGCAAACCTCGCG
GATGTCATACGGATTGCGCTTGGATTGGCTGAAGACCCAATACAGATTATTGATACAGAAATCACCCGCATCCGAGCAAATCGTCCCGTTAGTCGGCGCC
CGCTGGCACGCTTCGGTCATCTCGATGCAGATTTTCGTGTCCTTGATCATCTGCTCTTTCTGAGCGTCGTTGAGCAGCGATATGTTGTAGACTGCTTTTG
CCGTCTCAGCCATGTCAATCGTGTGGTTGTACTGCAATGAGCCACAGAGCCATTGGTCAGTCGATGAATTCAGGGTATGTAACAAACATCCGCCTATGCA
TCTTACCTGAATGACCGGATTGACCCATCCGTTGCCGATCGCGATGCCCTGCAGGTTGATCTTCTTGGAGCCAGGCTGCTTGCTGCCCAGGTTGTTCTGC
TCCATGATGTAGTGAGCCCCCGCCGGGATGTAGTGACCCCCGTAGCTCTC