Description :
From Genome Similarity Track
Location :
Scaffold_3713:2- 1349
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3713-fgenesh-gene-0.0ATP-binding Cassette (ABC) superfamily

Sequence
1347 bases(100 bases per row)
GACAAGATCGTGGTGTTGGCTGGCGGCGCGGTGGCGGAAGAGGGTCCTCACGACAGTCTGATCAAGATTGAGAACGGCGTGTACCGCAACCTGTACACAA
TCCAGGAAGAGAAGGCGCAGGAGGAAGCCGAGGCTGTTGCTGACGAGCTGGCGAACGTTCGTGGCGGTACTGAAGCTGAGGTCGTTCAGATGGTTCGCAA
GGACAGTATCCGATCTGTGAAGAGCGACCGAGCTGCCGACGTTGAGATCGCGAACAAGGCCGAGGATCTCGTGAAGAGTGGTCGTTTCACGCTTCGTGAC
GCCATGGCGTTCAGTCGTCCAGAGCGCAAGTTCTTCGTCGTTGGTATGCTCGCAGCTGGTATCAACGGCTTCACATTGCCGTGCTCGGCTCTTTTGATCA
GTGAAATGGTCGCGACGATGACGATGAAGTTCGCTCAGTACAAGGAGAACGGCGACCGGTCGTACTTGAACGATTTGAAGTCGGACGTCACAATCTACGG
CTCGTGCTACGTCGGGGGCGCGGTGGTGATTTTCTTCGTGACGATGGTGCAGAACTTTTGCTTCCGATACATGGCGGAGAAGCTTACGTCCCGACTGCGC
GACGTGCACTTCACGGCATTGTGTCGCCAGAACATCGCGTTCTTTGACGAGAAGAAGAACGCGACAGGCGCTCTCACTGCAGATCTATCGACGAACGCGA
CCAAGGTGGCGTTGATTTCGGGCGACTCGCAAGGACGCGTGCTGCAGGCTGGGTTCACGCTGTTTGCGGCGGTGATCATCTCGTTCACGGCGGGCAGTTG
GTTGCTGACGCTGATCATGCTTGCAGTATTCCCTCTGTTGATCATTGGTCACTTTGTCCACATGAAGGAGCTGCACGGACCTGGCGGACTGTCTGATGAA
CTCGCGGAAGTCGGTGCCCACGCGTCGGAAGCGCTCAGCAACATCCGAACAGTCGCCTCACTCGGTCTTGAGAAGAAGATCTCCGACAAGTTCTCTGCGC
TTCTCGAGGCTCCGCTAAAGAGCGGACGCCGCGAAGCCCAGCTGAACGGCTTTGCCGTCGGCTTTGCGTCCTTCATCCTGTTCGCGACCTATTCGCTCGT
GTTCTGGTACGGCGGCGTGCTTGTCGACCAACGCGACATCACGTTCAAGGAACTCATGCGCACGCTGATGGCGATCATGATGGCGTCGCAAGGTGTTGGC
AGCGCCGCTTCGTTCCTCGGTGACTCCGGAAACGCGGTCAAGTCTGGCGCGGCGATCGTTGCGATTCGCGACCGCGAATTACCGATTGATTCATTCGATG
AGTCTGGCGAGAAACCTGTCAAGGTCGAGGGCAAACTCGAGTTCAAG