Description :
From Genome Similarity Track
Location :
Scaffold_2401:2- 1345
Transcript NameFunction/comments
Phymu_g14093hypothetical protein

Sequence
1343 bases(100 bases per row)
GACAAGATCGTAGTGGTGAATGGCGGTCACGTCGTGGAAGAAGGCAACCACGATGAGTTGGTGGCAATTGAAGGTGGAATCTACAGGAAGTTGTACACGA
TTCAGGAGGAAAAGGCTCAACAGGAAGCGGAAGTGACTGCAGCTGTTGGAAATtgcgaagacgaagacagtCAACCACTCCTTTCTCGACGACTTAGCTC
TTGGTCTGCTTTCGATGGCGATGCCAGTGTCAAGCACCTCGACTTGGAACCTCAAGACGTTGGGAGCACGTCAAAGTTCACACTCTTCGACGCTATCGCT
TTCAGCCGTCCTGAACGGAAGGCATTTGTCGTTGGAATCATCGCGTCTGCAATAATTGGCTGCGCACTTCCTCTTTCGGCCGTACTCATCAGCGAACTGG
TGGTGACAATGACGTCGAAGTACACTGAGTACCAGACTTCCCACATTCAGTCTGCTCTGGATGATCTCAAGCACGACGTCATGATCTACGGCCTCTGCTA
CATTGCTGGAGCCTTTGTGGTATTCGTCAGCGCTTTTGTCCAGAACTTCGCGTTCAAGTACATGGCCGAAAAACTCACGTCTCGTTTAAGGGATATTCAC
TTCACGGCACTTTGCAGACAAAACATTGGCTTTTTCGACGAGAAAAAGAATGCCACTGGAGCTCTCACCGCTGATTTATCGACCAATGCGACGAAAGTGG
CTTTGATCTCGGGAGATTCTCAAGGACGCGTTGTGCAAGTTTTATTCacgttcgcagcagctctggtTGTTTCCTTCGCGTTGGggagctggctgctgtc
TCTGGTGATGATGGCTGTGTTCCCGTTCCTGATCATAggccaagctgctcgtgggAAGCATATGAAGACTGCTGGAGGCTTGTCCGATGAGCTTTCAGGT
GTCGGTGCACAAGCTTCGGAAGCGCTCAGTAACATCCGTACAGTGGCTTCTCTTGGGTTGGAGAAATCCCTTTCTGACAAACTctcggatcttcttgaag
agcCTTTAGTTCGAGGACGTCATGAAGCTCATGTGAATGGACTGGCACTGGGTTTTGGGTCTTTCGTCCTCTTCGCAGCCTACGCTCTGGCCTTTTGGTA
TGGGGGGAAACTGGTGGATGACGGCGACATCACGTTCAAGGAGCTGATGCGGACTCTGATGGCTGTCATGATGTCCGCACAAGGGATCGGAATGGCGTCG
ACGTTCCTGGCCGACTCGGACCACGCTCTTAAAGCTGGAAAAGCGATCGTGGACCTTCGTGACCGAGAAGTTCCCATCGATTCCTTCGACAAGTCCGGGT
TGCAGCCATCCAGTCTTGAAGGTAAAATTGAGTTCAAGAACGT