Description :
From Genome Similarity Track
Location :
Scaffold_3309:2- 1330
Transcript NameFunction/comments
Phypl_g15756reverse transcriptase

Sequence
1328 bases(100 bases per row)
TCAGGTTCGCCACTCTCGAAGACGTCACTCGTCTCTGTCAAGTCTGGATCCGCGCTGATCTTCAGGTGTCCGTACAGCGCATTGTCGATGAGCCGCTGAT
AGATCTGAGGTGCGTTCTTCAATCCGAATGGCATACGCAGCCACTCGAAAAGCCCGAATGGGGTGATGAACGCTGAGATCAGCCGCGCTCGCTCGGTCAT
GGTGACCACCCAGAATCCACTCGCCATGTCAAGAGAGCAGTACCAAAGCATCTTGTCCGAGTCTTCCAGAAGATTGTTGATCAGCGGCATCGGATACACC
ATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCGATGCAGAGTCGAATATCAACGCCggtcttcttgacgatgATCACGATCGGGGATGCCCACGGTG
AGGTCGAGTGCTTGATGATCCTAGCCGACAGCAGACCCTTGATGAGCGCAGCCAACTTCTCTCGAAATTGTGGAGCAACCGGTCGCACGCACTGGGCTAC
TGGAGTGGCACCAccgacgtcgatgtcgcacagtgcaccgcgtgctgcaggtggcagGGCGTTCCCTTTTCCGATCAGCAAgtgccgccttcgccagATG
ATCCGTCGCAGCCGGTCGATCTCTTCCGGGGTATTCAGATCGGGATCGCCAACCTGAATGTCTTCGATCATTACCCCTTCAGTCGAAGATGCTACCTCGG
GCAAGATGACCAAGTTCCGTTCGAGATCTTCTGCGAACAAGCCGCCGCCCTCATGGTAGCAGACCTGTTCTGCCTTAGCTTCAGCCGAGCTCGATTCCAG
TGAAGTATCGACTTCGGTCTTCGGCAGATCTTGTCTTGACTTGGCGGACCCCTCTTTCTGGATCGGTGCAGGCTCCTGGGCGACTCGCTCTTCGTCCACC
TCTTCACGCTTCACCTCGGCTTTCGGCAGACCTTCCCGTGTTCCTTCGCAGGGCGATGGTAAGACTGTTGCTACGGCCACCACTGGTTTAGGAAGCCCAT
CCGACCGACTCAGAAttcgcgtcggcgtcggatATTGAGGCCGATCCACCAGCGGTTCCACTGACTCTTCTTCGGGTCCGGGTTCCTCCTGTCGCTCGGT
GGTAGCCTCGAACGCGAGGTTCTGTCACTCAGCGTATCTGGGCGATCCGACTGAAACAAAACCTGGCATACGAGGTACGGCGTCTGGGGCTAACCGAGTT
CCTAGCCGTGCGTGCCGATCGAGCACTAACTTCTCTTCGCTCACGTTTGTGATCCGCAGATACCTCGTTCTACCCAGACCCCTGATAGCGGTCGGCACCC
ATCTTGATCCCCGTGTGATCCAGAGCTT