Description :
From Genome Similarity Track
Location :
Scaffold_1489:2- 1326
Transcript NameFunction/comments
Phyra_41946AF232997_1 reverse transcriptase-like protein

Sequence
1324 bases(100 bases per row)
GCCAAGCTGAACTCCATCCGTGTATTTCTTGCGTTGGCTACCCAAAAAGGGATGCGCGTACGCCAAGGCGATGTTCCTACGGCGTCCGTCAAGGCAGGGT
TGTCCGAAGTACTTTATGTCCGGCAGCCCCGCGGGTTTGAGGAAGTAAGTCGATCCCATGTGTGGCGACTCAAAAAGGCATTATACGGCCTTAAACAAGC
CGGCCGGGAGTGGAATGTGGAGCTCAACAGTTGTCTCATCGAGTATGGATTGTGTTCAACAAGGGAGGATCCGTGCGTGTACACCCATCCAACTAACGAA
CTAATTGTTCTTATCTACGTCGATGATATTCTAATAGGTTATCATGATGAGCAGGTACTAGAACATTTGATGCAAGCTCTTTATTCCAAGTACGAGATCA
AAGATCTTGGAGACGTACGGTGGTTTCTCGGCATACGCATAAACATGGATACAGCTCGTGGAATCACCACTCTCGACCAAACCCAATTCGCATCAGAAAT
ACTGCGACGTTTCGGTATGGAAGATTGTCGACCCCGAAAGACCCCGTTAGATCAAGGCACGATTTTATACAAACGAACTCAACATGATGATGAAGATCAA
GAAAACCCTTATCGACAGGCTGTCGGAGCCCTTCTCTATCTCGCGCGCGTTACCAGGCCCGACATTGCATTTGCGGTGAACCAGGTTGCTGCTCATGCCT
CAAGTCCAGCTCAGTCTCACTGGATTGCCGTGAAAAATATTCTCAGGTACATTGAAGGAACCAAGAACATGGGCTTGATCTACAAGAGAAATAAGTCAAC
TGTCCCCGTCAGAGTGTACACGGACGCTGACTGGGCCAATAACGAGGAAGATCGGCGATCAATCTCTGGAGTTCTCGTTCAAGTTTTCGGTAACTCTGTG
TCTTGGCAAACAAAACGACAACGACTTGTTTCCAAGTCCTCTACAATTGCTGAATACATTGCAGCGGATGATGGAGTAGAAGAAGCATTATGGACACGGA
TGCTGCTTCAAAGACTGATGAAAACTCAAGCTCTCGACGCAATTCCAGCGATGATTGACAACAAGTCAACCATTCAAAGACTGTTAAACGGAAAAAATTC
CGAGGCACAAAAGACAGTTGATTGTAGCATCTTCTCGATACGGGATGCTATCCAATCTGGGCATCTACAGCTCAAGTACTGTCCAACTGCAATTATGTTA
GCTGATGGACTGACCAAGGCTCTTGGATCTACACAATTTAGTGAACGCCGTGAAGCAATTGGCATCGAAGAATTGACATCCAGCGCTGGTGGGGAAGTGT
TGAAGTAGCCAGCCTGAACTTATC