Description :
From Genome Similarity Track
Location :
Scaffold_4067:2- 1326
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4067-fgenesh-gene-0.0Serine protease family S10

Sequence
1324 bases(100 bases per row)
ACGAGGCCGGCTACATCACGCTCACCAACAAGAAGGATGACCACTACTTCTACTGGTTCTTCGAGTCGCAGAGCCTCGATCCAACCAAGGACCCGCTCGT
GATCTGGCTCACGGGCGGACCTGGCGGCTCGAGTATGTATGCACTCTTTAGCGAGAATGGCCCGTGCTCTGTGGAGGCAGACTTGTCGACCAAGACGAAC
CCGTACTCGTGGACCAACCAGGCCAACGTGATCTGGCTAGACCAGCCGACCGACGTGGGCTTCTCGTACGGCGCACCCGAGGACGCGGACGTTAACGGCA
CGAACGTGGGCGAGAACCTGTACTGGTTCCTCCAGGGCTTCATCAACAAGCACCCAGAGTTTGACAACAGAGAGTTCTTCCTCTTTGGAGAGAGCTATGC
GGGCCACTACGTGCCCAGCGGCGCGCACTTCATCTGGCAGATGAACAAGCTGGGTGATCAGCAGCCTGGCGCCAAGCGGATCAATCTACAGGGCATCGGC
ATCGGCAACGGCTGGGTCGACCCCGAGACGCAGGTACGTAGAGGGCTGTTTCCTACTTTCCTTGTACGCGTACTGACAAGTGTGTGTGTCGTGTAGTACT
TGTATGCAGACGCGATGGCGCACAACGCGTACAACATTTCGTTCCTGAGCGAGGCGCAGATCACACAGATGAAGAAAGACAACCTCGTGTGCGTGGAAAT
GGGTCTCCAGTGCCGCAAAAACCCTGGGAACGGCTCGATTTGCCTGGAGGAGCAGAATTTCTCGTACGAGAAGCACATTCTGCCCTTCCTTGCGGCCAAG
AGGAACCCGTACGACATCCGCGAAGCCTGCGACATGGAGGTCGATCCGCTTTGTGATGCCGAGAACCTCGCACTTACTACCAAGTTCTTGAACTCCGACA
GAGTCCGGCGCTACCTGAACGTCAACGTAGGCCCAAAGAAGCGGTGGGAGGAATTGAATGGCAACGTCAACCTCGCGTTCATATCCTCAGGCGACAACGC
GCAGCCGTCGCAGCTGCTGGTCGCTGAGCTGCTCAACGACGGTGTCCGCGTTCTCGTGTACAACGGCGACGCAGACCTCATGTGCAATTGGCAGAGCAGC
GACGCGTGGACCAGAGCGCTGCTTTGGAACGGCGCCGAGAAGTTTAATTCTGCCCAGGAGCGCACGTTCTGGGCTGACGATGCGAATGTGGCGGGAGCGG
AGCCCGTGGACGCTGGCCGCGTGCGCTCGTTTGAGAATTTCGCGTTCGTGCGCGTGTTCAACGCGGGTCACATGGTGCCGAAGAACCAGCCAGCGGTCGC
GCTCGACATGCTCAATAAGTTTCT