Description :
From Genome Similarity Track
Location :
Scaffold_761:2- 1320
Transcript NameFunction/comments

Sequence
1318 bases(100 bases per row)
TCGAGCTTACCTTCAGGATGACAATGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCC
GATGTCGACACGCTCGATCGCATCACCAGCAGGCGCGGGGCGCCCTGCTGGTCCCTTTAGTTTTTTGATTGTCCGTGGCGATACCCAGTATCGCCACGAC
GGCTCCTCGCCGCGTGCACAGGTGCTCTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATACACGACGCTGCTG
GGAAACAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGT
TTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATCGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCAT
CTCTAAGGCCTTTCATGAACGTGACGACCTATGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATG
CACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCC
TCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACA
ACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAACTGCTTACGTGGAG
TTTCAATGACTTCACGCGCGGTGTGGCCGATGGTGACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGT
TGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGT
GGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTC
CATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACG
TGTAGGAGGAAGCGTAGG