Description :
From Genome Similarity Track
Location :
Scaffold_197:2- 1319
Sequence
1317 bases(100 bases per row)
GAAGACTTTTGCGAAGAAGCGGGGTTTTCAACTGTACGTCAAGACACAAAGCGTGCAGGCAAACAACAGTGGAAATGCAAAATACATCTGCAAGAAACTC
AATGGAATGCAGTCTTTTGACAGTGAACCCAGCGTTGAGGAGTTGTGGTGTCCATTTTTCGTTAATGGGTCCGGGAAGAATGGAAAGTGGAAGGTTACGC
AAGCTAACTTTTCCCACAATCATCTCAAACACGTCGGAACAACGAAGACTCCTCCCTGCGAAGGATCGCTACCAGCTCCTCCAAAAGCCTTGCGTAGTAC
AACCCAGAGAGTCTCAGATATGATTGCTCTAGTTGAGACAGATATGCTGTCTTCGTATAATTATTCAGTTTCAACAATGTCAGGAACTGCTGTCAAGAAT
TTCCTGACCGGCAAGGGATATGATACAAGTCTCACAACCGTATATGGCATAAAGCGTAAAATCGACGACAAATTGCACAGCATTTTACTGGAAAGCTACC
GAAAAAACTGCGTGCTTATTTGGCGGTCATGGCAGACAAAAACCCAGGTTCAAATTGGAAATTTGAACAAGTAGATGACGATACTTTTCTCCGAGCTTGC
TTTGCACCCAATGTCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN