Description :
From Genome Similarity Track
Location :
Scaffold_2203:2- 1312
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2203-fgenesh-gene-0.0Transmembrane protein

Sequence
1310 bases(100 bases per row)
GCCTTCCTCATGGCGTACGGTGCCAATGCGTTCGCGGCATTGCGCAAATGGGGCTCCAGCAACTACAGCGGTATGCGTTATACCGACGCCGTGCGGCTGT
TGCTGCGCGCCGACACGATCCGCTTTGGCGCGTTCTTCGGTTCGCTGGTCGGCGTGTTTCGCCTCACGGAACTCGCGGCGCGGCTCGCGCGCGGTGGCCA
AAAGGACGCGACCAATCTCGCCATCGCCGGCGGTGTCTCGGGGCTCGCGCTATTGGTCGACTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGCCGCAGCACGATCGCTCTGTACGTGTTCGTACGAATGCTGGACGTGGTGGGCCGCCACTTGAC
TGCGATCGGCACGATCCCGTCGTGGCAGTACTCGTCCGAGATTCTCTTCGCACTCAGCAATGTCCCCATCATGTACGGGCTCATTGCTGACCCGACGGTG
CTGCCCAAGAGCTACTACAACTGGATCCTCCACATGGGCGGCGTGACCGACCACGGACTCGACTATGTCGTGCGCCAGGGCTGGCGCGGCGAGACCGATG
CCGAGGGAAACCCCATTGGCTTTCGCGGCTGCCAGCCGCACTACCACGTGTACGTATGTCTATCCGCCCGTATTCCTGCGGCATGCTAACCGATCGCTTG
TTTCTGGTGTCGTATCTAGCGAGTCGTGCATGACCCACTCAACGAAGGAGTGGTTTGGCGGCCTCGGCCGTGCGATCCGGATTTACTTGCCCGTGCACTT
CCTCCCCGCGATCATCTTCAAGTTTCCGCGGCTCCAGGGCGCGCCCGTGACGATGACCGCGCGGATCTCGTACGCGGCATTGTGCTCGTCGGTCTTCCTC
ACGACGTACCAGACCATTGTCAAGCTCGTCGTGTGCACGATGCGCAACACGTTTCAGCACGACTATGTGATCGAGTCGTACCTTGGCGGAGTACGTGACC
AACGTCCATTGCAGTAGCCCATGGGATCTGACGCACCTTTTCTCTTTTCCGCCTGTAGCTTTGCACTGGCCTGAGCCTCTTCTTCGAAGATCCCAAGCGC
CGCTTCGAGCTGATGCTGTACTGTGCGCCGCGCGCGATCGACATTATCTGGCAGCTTCTCAAGCGCCGCGGGTTTGTGCGCTACGTCAAGCACGGCGAAG
TCGCGCTCTTCTGTCTGTCCATGTCGTTGATCATGTCGCGGCCGCCCGAGCACTTCAAGCCGACGTACCTCAGCATCTTGCGCTTTCTCTTTGGCCGCAA
CACTATTTAA