Description :
From Genome Similarity Track
Location :
Scaffold_3279:2- 1298
Transcript NameFunction/comments
Phyta_totarag15191hypothetical protein PHYSODRAFT_260744

Sequence
1296 bases(100 bases per row)
TTCTCCGGGCGACTTGCGGGTTTATcggtaaaacgaactctgtttgtCTGTTATCTGTTCTGGCtatcttctgctgctataGACATGCACATATGGTTTT
GACTTACTTTCAGTATGGTGGTGTCAACGTAATCGTCTCTTGACTTGGTCAGTGCATACTTTTTGCGATTTGGAGTCGGTGGgttcattgctgttcttca
aggtTCCGTGGATCTTGACATATCTTGGTCGGTCGAGTTAATCGGTCGTTATTCACTTGGTCTTTGTATACGGGATATCCACTGCCGGGGTGATCCAATC
GGAATCACTCGTCCGGGATACACTTCCGAATATATCCATCCGGGACTTGTGTCCGGGATATATTCACACTTGGGGACTTATTCTGGGTGCTTGGAGTTCT
TGGTCGCGTTTATACATACTCCGCACCGTGTCAAGACAGATGGCTCTCTGGTATGTAATTTACCAGGAGCACTTTACACTCCCGTAGGCTCTTACCTGTC
GTCAGGaactcagcttcatccagacttACTCGTCTTGAGACTTTCGGGTCTGGGAATGCCGAGCCTATCCACGGCTAACCATGCTCCCTCACAATCCATA
ATTCATCCATAATCCACGGGTCACATCCAGTGGTGTACTAAACTGGCCCCTTCGACTAACCAACCACAGTCACCCCCAAAAATTCGGAGTCCCATCGTGT
CAAAAGGTCTTGTTAACCTTGCTCATGTCTCAGGCATCCCTGTCGAAGATCCACTgcgtcgccagcttctcgtcccCGTTCGCATGCTGAgcacctcctc
gtcgaaAGGATTGTGACGTTAGATGTGCCCGCTGGATCCGCTACGCGCTTCAGGAGGCGGTTCACGTACGCTGGGCTCCATCGTCGCCTCGTGTAGACTC
CATCGATCGACGAGGTGGGCGCGTAGAAGCCGATGGCGCCGAGCTTGGGTCGTCGGCAAGGGGAGTTGCGACAGCACTGCGGCGGAAGCACATGGGGTCG
GCGGTCGCGTACGAGCTTGGCGTTGCCAGGGCTACGTTCAACGAGGCTGGTTCTggctccagcaactcaaacAGCGGTGCACCCGGATCAAGGTCACCAG
CTTCGGCAGGCACAAGCTCAGGGAGCTGGCTCAGCAGGGAGCCACATGGAGCGTCCTGTGTGACCAACGCCGCAGCAAACGCGTGGAGCGGACAGGTAAG
GAAGTCGTTCCTGTCAGGGACGAGGGTGAGCCCTTGCTCTTCGACAGTCTtcacgcgcagcaggcgcaggtAGAAGACGCTGTCAGCTGACACTGA