Description :
From Genome Similarity Track
Location :
Scaffold_3702:2- 1296
Transcript NameFunction/comments
Phypl_g15985pol protein

Sequence
1294 bases(100 bases per row)
CAGTCGCGTCGGgcgaagcaggagaagaagtcgTGTAAGACTGCGTGGGACTCGCATTCTGCGAGCGACTCCTCGATGCGATGCCGTTAGCAGCGGCATA
CGATGTGTCGGCGGAGGTACCGGTGAGAGATACCGGTACCGACGGAGCTACCGGTTGCAGTATCGGTGTGGCTCCTGATGCAGTATCAGCTTCACTCGAC
TCTAGCGCCGATACGCTCGGCGCTTCTCCAGATCCTCCCCCACCAAGAGTGGAGCCCGTGCTCTCTATCATCGACCCCagggcgagcagcgccggaACGC
GCGGGTGCCACGCGTTGTTCACGAAGAACGGCGTCAACCCGGTTGACGCGTGGACGGCATTGTTGATGGCGAATTCGGCAAGCGGCAAGAAGGAACTCCA
CGAGGAGAACGACGTGGCGTAGCTGCGAAGGACGTCTTCCAGTACGCGGTTGACGCGCTCCGTTTGCCCATCCGTTTCCGAATGGGCCACCGTCGACATC
AACAGGCGCGTaccaagcagctcgaagagtCGATCCCAGACGGCTGACGTGAAGCGCGGGTCGCGGTCGGACACGATGGATTCCGGCAGACCGTGGTGCT
GGAATATCAGATCGAGGAACAGTCTGGCCGTGTCATCCGCGGTGACTTGAGTGGCGACTGGAGCAAGATGGACCATCTTGCTGATGCGGCAAACGAAGAC
CAGGACACCCGTGCGGCTCTGGTCGTCCGGAGGCAGCCCGAAGATGAAGTCCGTGTTGACAGAACGCCACGCATCCGTAGCAATCGGCAACGGATGCAGC
GGAGCctgcgacgaaggcgagggCTTGACGCGTTGACAAGTCTCGCAGGATCGAACCCACTTTCGAATCCACTTGTACATGCGAGGCCAGAAGGAGTCGC
GGGATAGCACAGCGAACGTCTTCTCGCGACCAAGATGACCACCGACGGGAGCATGTCAGGATATTCATTGACCAGACGGGCACGGAGGTCGTCATCGGCT
GGGATGACGACGCGCGGCGAGTCGAAGGTGTCAATCGTGTACATCAGAAGCAGACCACCAAGCTGGTAACGCTTGATGTGATCGCGAGTTGGGCTTGTTA
ACTTCTTCAAGGGCGCCGCGCTGGGATCTCGAAGGTGTGCGATGATGTCGGCGTAGAACGCATCATTGTCGTATGACTCAATGATCTGCTCGCGGAGCGG
TAGCATCGGCACCGAGATCGTCGTGTTGATGCCAAGCTCAACACAGCAGGCGCattcatcgtcttcgtcatcgacATCAGAAGCCTGATGTCCA