Description :
From Genome Similarity Track
Location :
Scaffold_3897:2- 1295
Transcript NameFunction/comments
Phyta_totarag15535hypothetical protein PHYSODRAFT_325775

Sequence
1293 bases(100 bases per row)
TGGAGTCGTACTCTCAAGCTGCGATGGGACGCTTCTTGAAGGAACAACAGTCCGCTCCCCGTCCACGAGTTGCGAGAccgactggagatcaagacgtGAA
GATGGAGTCGATTGAATCGCCAGATCACCACTCCTCTCCATGAGAATACGATCCCAACGACCTCGATTTTACCGCGACTACTCGCGCAGCGGtgcggcga
cagcaacttcacaTGCCGGAAGATCGACAGCCGCTCCACGCATCCGCGTGTCGGCAATGTCCGAACTGAAGGAGTTTACCGGAAAGGAGGGCGACGAAGA
TCGAGCCCGGTCCTGGATCGGCAAAGCGCAATCAGCGTTCATCCGAGATCAAGCACCTGATGATGAGAAGTGCTTGGTCTTCGGCGATTTTTTACTGGAC
CACCGCGGAACTGGTACCGGCAGTTGAGCCGCACGACTCGCAGCACTTGGAAAGATCTGCTGTTGAGCTTCCAGACGCAGTGCTGCGGCCGTCGTGAATC
TGTCGCGAGACAATACTACCACGCCCGGAAGCGATCGGACGAGTCGCCGCTGGAATACTTGCACCGTCTCAACGTAGCTAGGCTCCGTGCACGTCTCCAG
GCGAAGGATGGATCTCCAGAGACCCGACGTGAACATGTCGACCACTTCATCGAGACGCTGGATGACCGTGCTCTCGCCGACCACCTCGCCCTGTTGCGAG
TCCCAGATGTCGATACCTTGGAAGAGACGCTTCGATCGCAGCAGTGCGAAGGTGCGTCAGAGCAAGAGATTCTATGGATCGATCAATCCCCGAACGAGAG
CACAGGCCGCAGCCGCACCGTCAGCCACCATGCGAGCAGTTCGCGCGACTCACGTGGCCGACGACAGTAGTGAGTCGGAAGCGGAGTCAAGCGGATCGGA
CGGCGAGGCGGGACTGCGCAGAGTGTATCTGACGGCAGCTGAAAATCATGGCGAACCGCATGATCGTGGGCCGCCGGATCAAGACCGGGGCCGTACAGGG
CACGCGACCCGGAACCACCAGCAAGCTCGGCACACCAGATCGACTGACCTGGGGACGTCGTTCAACCGCTGCTCACACTGCGGGTCGCGCAAGCATACCG
ATCTTGGATGCTGGGGACGCTTGACCTTCGAGAAGTGTGGCCGAAAGGGGCATCCATCCGACCGATGCTTCTTTGTGTGCAAGGCCTGCGGTGAGATCCA
CGACACTGACCAATGCCCGATGGAGGAGTTCTACAACTTGATCCGTCAGTGGTTCAACCCCACCTAGCACGCAGGCATGCTGCCGGAGACAGC