Description :
From Genome Similarity Track
Location :
scaffold_134:2- 1256
Transcript NameFunction/comments
Plaha_PHALS_04286hypothetical protein

Sequence
1254 bases(100 bases per row)
catttgcacacacaagcacgcatcacttctacctctgcccTTCTTATATCCTTTATTTGTGATAACGTTTTTGCTTCGGATGACTTTGATTCTATCGTAG
GCGTAATGAAGCTTTGAGTTTTAGCTGATGTCGTCTCAggggacgtgctacagcaaacctGATTCGATCAgacgcatccgattgacgcGATGGCAATGAA
TCGGCGGTGTGCATCTAGGAGAATCTTCATTTTGATTTGTGGAAGCAGCGCAACCAGCTCAGTCATGATCACCTCAAGTTCACCTGCAGGGACATATGTT
GGACTTATTACCCGACCGTTATTGCGCTTAACCCGTACACGATTTTCCAACAAGATTTTTGAAGCGGTATCGCACAATAGGGCCCTTGATTTTGTCCTTG
AAAAAGTCTGGGTTTCTGTTTAGCTTGTTGGCCACATCATCCCACGCTGCCAAAATCGCTTCAAATCTGGCTCGAACAGGCAACAGTTCCTTGACATACT
TGATAAGCAAAATGTGATCCTCTTGGGTgtaccgttgacgagtgGCCTTGGCGAGAACCTGGTCATCGGTTTTCACGAAAAGCAAGGTGGACGACGACTG
CGGTTCCTTTGAAAACGGGGCAATAGCCATTTGTGAGGACACAACGGATAGCTTCTTTTCGACCAAATCGTTACTGTCTTCAGGTCGAATTTCACGAGAG
CGACCCCGCTTGCCCAGTATCTGGACCTGATCTTCCCTCTCGGTGGTGTCCAGCTTGGGCACCACCTCAGCCATGACATTACGAAAAGCAGCGCCTGTGA
TAGAGCGCTTGCTGGCCGACTCCGGTCTTAATCTAATCGCGGTAGCGCACTACAAGGCGCTCAAAACGTTTCTTGGCGATGGGACCTTTAAGGTAGTGCA
TTGTAGAAGCATGAGAGTCGTTTAGAGTCGTGGTGATCTCATCCTACCTGGCCATACGGTGCGCGAAATGGCATACTGTGTTCACTTGAGCTGCAGGTAA
ATAATCCAATTTGGGGTCAAGGCGCTGGCGAGTTCGCTGCTTGGGTGTCATGATTCAGAGGTTGCTTCAATCTTTTCTCTTAGCGATTTCCGTATTCTAA
TTCCAACTCTCACTTTTTGTAAGATCGTCGCCTATCATAAATCTATTTTGTAATTCGACTGTACCGAATATCTTTTCTTTTAGTTTTCACGTCGTAATAC
AGTAGACTCCCGCTTAAATACGCCAATTGATCCAGTACGGTTTGTGTGCACTTA