Description :
From Genome Similarity Track
Location :
Scaffold_1908:2- 1252
Sequence
1250 bases(100 bases per row)
AGGTACACCTCCGATTGAATGTTGAAGCTCCTCCGGTTCAAGTTAGCTACCTTATGCGTAGACACCGCACTCGAAATGCAACATTAACAACGGATTCGAC
TAAGATGTTGCGGGACTTCCCCTTGATGAATCGCATACCCATGCGTCGGAGGGCACGACGTAGGGACCGCACAGAGACAAAAATAttttgctcttcttct
gcttggggGCTGCAACTGGCTTTCCACTTTTATTCATTCTGGAAACCAATTTTCGCTCCAGGGGATGCAAGCTCTCCCCGCACGTACGCGGTCTACCAGG
TGATTTTTGACCTCCCATCTGTCATGTTACAGCAACAGCACAGCGTACAACCTACCGAGGTGAACTTCCGGTCGTGGTGCCTCTCCCAGTGCGACCAGAT
CTCCGAAATGGTGCTTTTCGCAAAGCCCAAGCACTGGTGAACATAATTGCGCACTTCACCTTTCCATGCCTTTGGTGCCGTGTGCATTCGTAGGTCTTTG
CAACGAGATATttttcagcagcagataGTTTTTACCGGCCGTCATTTCACTTGTGTGGATTGTATACTGTCGTTGTGCTTGCTTTTATATTTAGACAAAG
AGCTTTCTAATGGTGGTAGCTGCAGTTAAATGGAGCGGCGGGTTACTGAGAAACGATTCATCACAAATTAGCGCACTAAAAATACAATTTTCCGTCCGAG
GTTTTTGGCCGGGATAATACCTGATGAAGTGGTCATCCCACTCGTCAAGTCGAAAAGCGCCGAACTCAGCGCACCGTCTTATGGTAGTCACGTTATAGGC
GGTCCTTCGGAAATACTGACCATTCCAAGTCGGCTGATAGCTGAGTTCAAGTTGAGACGTCGTCAACCTGACGAATCGACTCACGAAATATGGGTTCGAC
GAACAAAAGGTTGGATCCCGACGGTGACGCACAACACAAGTGGAAGACCCACCCGTGTGATGCTcacgagtacgagctgcaggttAACAGGGTGTTCGGC
TCATTTTCCGGTGGTATTGTGGGCGCCGCATGGTGAATTACCACCTGACTCGGGATATGTCCGGCTAAACTCAGCGAAATACCGAGACTGGCAAGTACTA
GCGTATGAGTCAGCCCTCGATAAAGACTTACTCCGGAGAGAGCAACAGTTATATGCTGAATGGTTAGCTCGTCAACCCCCAGTGGTGGAGCGACGATCGT
ACCGTACTCCTGAAAAAGTGATGAGTCGGTCGAACCGAGGATCGCCAACG