Description :
From Genome Similarity Track
Location :
Scaffold_3871:2- 1242
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3871-fgenesh-gene-0.0Haustorium-specific membrane protein

Sequence
1240 bases(100 bases per row)
TGAGGCACCCACAACAGCAGCGAACCGCCTCCCGTGCCAGGGATGCCGAAGAAACCCGGACGCCAGCGGTCCAGGTACAGCGTCTTGTCCTTCAGCTCGG
AGATCGCGCGGGTCCAGACCACGGTCTTACCCTTCTTCACACCCACCTCAGTGATCTTGTTGCCGCCCGAGATGACGTTCACGGTCACGTCCTGGTTGTC
CGTGCTCACGAACGTGATGGTCACGTTGCCATTGCCGGCCTTGGTCCAGGCGCCGGAGCTCTTGTCGAACGCCTTGCCCATGGTGCGGAGACCCAGAGCG
TCGGTGGCCACGCCGTCGTCGATCTCGCCGAGATACTCGGTTGGGCCGCAGATGGGCTGGATGAACTCCTTGGCGAGTGCGACGATGCCCGTCGGGTCGA
ACTGCGCCACCGCGTCGAGACCCATGTCCGCGATGCGCAGTGCGTAGTCACCGGCGGACAGCGGCTTGCCACCGTTGCTCGACGAGTCGATGATCTGGTC
GATGATCACCTGCACCGTCTTGCGAATGTCGTCACGGGTCATGTACGCGCCGTCCTCGTTCTTCGGCACACAGCTCGAGGTGGCGGCCGGGATGTCCTTG
AGGAACAGGTCAGAGTTACTGATCGCGAGGCGGATGACGTCCACCGCGCTGGATGGCTTGCTGGTCTTGATCTCCTTGACGGCGGCGACGACGCGGTCGA
TGACACTCTTGAGCTCCGTGCCGCACGTGATGCCCTCGTCGATGAGCTTCTTGAGCGCGTCCGTGCCGGCGGTGTCCAGCTCCTGGATGGCGGCACCGAC
ACCGACCTCGTTGGTGACTTCGATGAACGTGTTGGCACCCAAGATGCTCTCGCCCTTGGTCAGGATCTTGTCCAGGTACTGCTTAATCACGTCAACGACC
TCCTTGGCCTGCTCGACGCCCGTTGGCGCTGGGAGGCCCAGACACGTCGTGACCGCCACCGGCAGGTCGTAGATCACAAAGTCCGACTTGCCGAGCAAGT
AGGAGAACTGCGAGCGCGTGGTGTTCGGGAAGCTCACCTCGAGCTCCTTGGCGTAGCCCACGATCTTGGTAGTGACGGCGTACAGCTGCTGGCCGCACTT
GACGCCGGTCTGCACCGCCTTGCTAGCAGTGGCGAGCTGGCCGAACACGCCCGAAGTGGCGGCGTTCAGCGCCACGGTCGCGACCGCGTTCACCTTGGAG
ATCACTTCGAGCGTGCAGTCCTTGTTCTGCGGGATGCACT