Description :
From Genome Similarity Track
Location :
Scaffold_627:2- 1220
Sequence
1218 bases(100 bases per row)
CCGCTTGGGATACGCCGGGACGTGGAGCCACGTCGTTGGAGATATAGCGTCCAGCGACAGTACCAGCAGGCACACAAGCTAGCCAACGAGGCGCTGCGCG
ATGCGATCGAAGGGAGATCAGATCAACACAAAGAAGATGTGAGCCTACATGACATAAAGACAGGAGATCGAGTATGGCTATATCTAGATCGAGTTAAGGA
AGGCTACACTCGTAATATCGCACTTAAGTGGCATGGACCATTTAGAGTTGCGGAGACAGTCGATTGGCACGCGCTACAGCGGCACAGAGTACCGACTGTT
CCCGATCGTCCATGTATGAAAGCTGAAGCTAGTGAAGAGCTACCCAGACTGCCCGACATCTACGCTGACGAACCGTGAAGCAGATCGCGTAGACTTTGAC
GAATGCTTGCTGCCCGAAGACAGCTAGGAGCGCGAGCTCGATGAAGACGAGAACGAAGCGGAGGAGGTCGCTGGTGAGCGCTCGAGCAAGAAGACTCGAT
ACGGCCGCACGCTACGCGAGTACCTGGGCTACGCCGAGCCGTCGTGGGTCGACGAGACTGACCTCAAGTATGGAGCGTAGCTGAGAGATTTCAAGCGGGG
GAGGACAGATCGCTACCATTTCGAAGCAATGCCGTCGCATGAGGAGTGAGCGGTGGGAACATCAGTGATGGAGAGGTTATTGCAGAGAAGTCAGCGGAAG
AAGAACTTCCAGGAAGGCGGTATGTTTCGGGAGGAAATGGTACATGTGGAGTGTGGTGGGCCTGAATAGGCCGGAAAACTTAGGCACTACGCTTCGGAAG
ATTCTGGAGAAAGAAAAAAAGATACGAATGGATTAGATTGGATTAGATCCTCTCGACGAATGCTGTAAAACTACGGAGCTGCTGCCTGACATACAATGAC
ATGGAACGATCAAGAAGAGGAATGCGTGAGCTTGCTAGACAGACGAACGATCTCAAGAGCCAGGTGGTCAGCCGGTAATACCAGCCTCGTCTTAGAGAGG
GAAATGCAGGAAGAATGGATCCAGCAACAGGTCGAGGTTACAGTAGCCCCGGAGCATACCGATCAGCACTTGTTGGAAAAACGATTTACACCGGCTCTGG
ATCGACACTGCTTGCGGTCGGTGTAGAATGCTTCCAAGTATCGATAGTCGCGACGCTTGGCGATGCTCACCGGGAAGGCGTGCGTGGAGCGCAAATCAGC
CCGAAGTTGCTCATCTTC