Description :
From Genome Similarity Track
Location :
Scaffold_3886:2- 1211
Transcript NameFunction/comments
Phyta_totarag15528hypothetical protein

Sequence
1209 bases(100 bases per row)
GTTAGTCGGTGcctgggcgctgttggtaagccggatccagcaacttcgcagattttgctgatcccgctacaccacgcagctgttgctgttgccacgACCG
CACGTCGGGTGGGCAAAACTTCGAGGTCGTCAGGATCATACTCCAAGTGCTGAAGGTCCGGGGTCCGAtcgactccatctcgacgtcCTGGGAGCCGGGC
GATCTCGCCCGAGTGACGACTCGTGGGGTGGCTGATGCCTGTTGCTCACGCAGGAACCGGCTCATGGCAGACTGGAAGTACGTCTCCAGTCTGTCTGTCG
GCTCGTGCGTTGGATCCGTGACTGCGGGTCGAGCGACTGCACGACGTGGCTTCTCTGGATCCGTGATCAGGAGAGCTGTGCGGGATCACAGCATCACTTC
GCCCGAAGGGTCAAGCGGCATGCGTTGCAGACTGCTGGATCTGTCCGAGTCCACCTCCGACGTCGCCGAGGCGTAGTGGGAGGATCCAGTCTGGTACTCC
GGGGTGCGGATCTGGAGAGGCGGCTAACGATCCTCAGTGCGAGGTGTCTCGTCCACAAGGATCTCCAGCTTCCCGAAGAGACCCACAACGTAGTCTTCAT
CACATCCAAGTCCAGGTTGAAAAGGTCATTCGCGTCGAACGCCCCAGCAACGATGCCAGCTTCCTTCAGCAAGATCTTCACTGTGGTCAGCTtgttcgtc
gtcgccggtGGAGCAGTTATGGGTCCCTCCAGATCCccgagcagctgcaactgTAAGATCTTCATCACAGGGTCGTGATCCAAGAACCTATTCAGCTCCT
TTCGGTGGTAGACGTCCTCCAGTTGGTCTTCAGCCCATGTAAGCCTCAATTCATCACGGTCTTCACCTTCCAACTCTAGAGCCTTGAGTTTCTTCCGCGC
GGCCTTGTTcttcgtgttcttcttccttgatGCAGTCTTGGAAGTCGGTGGAGTGATGGTGGATCTCGATTCGAATCAAGATCCGCGGGGGTCCCCGGAG
GGACCTGGGGAGGAGGTTGAGGTTTTTCTTCGAGATCCGGGTCCGGATCTCCCTCTCTTCCGTCGATAGAACCCCCTCCCAGGGCTCTGTCGTTCCGTGG
ATCTAACTttcagcgacgtcgtcggcgaTCCAAGTTCCGTCGACGCATCATCTCCCGATTCCTTGCTCGCAAGCACATCTTCTTGGGACTCACGGTGAAA
TCCGGCGTC