Description :
From Genome Similarity Track
Location :
Scaffold_3881:2- 1201
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3881-snap-gene-0.0Reverse transcriptase

Sequence
1199 bases(100 bases per row)
TTTTAACAATTGCAGACCCAGCATGAGCTCTTGATACTCCGCCTCATTGACTGTCAAGTCTCCCTCGAACCCCGAAGCGGTACTCACGAATGACCAACTT
GGGACTCGCCAGACAACTGCCGCAAAGGAACCCTCCACGCGCTTGGGTTTGGCCGATCCAGAAAAGCTGAGCACCAACGCCAATTCATCTCCGTTCACAC
AAGGTAGCGGTATAGGCGGAACCTTCTTGGAGATCGTACGAGGAGTGATCTGTCCAAGAGCGAGATCCATCTTGTCAGTCGACGTTATGCTCGCTGCCAT
GAGCCCACAGATCTCATCTTCCCCCTTGCTCAGCTTAGACACCTCCAGTGCCCAAGGAGATAACAGTGCTCCCCACTGCGATAGACACCTCTGCAGCTTG
TTCGATGGCAAAAGCCAAGCCAACGTGATGTGATGTGTCAGAACGCGGACCTTTTTACTCGCAAGCAGGTTAAAAGCGCTGCCCAGCATTTGTAGAAGAC
TCAAGATCTTCTCTACCGCGCTGTAGTTCAGCTCATTCGCCTTGAGCGTGCGACTAGTGACCTTTACTGGATGGTATACACCATCGTGCTTCTGCATCAA
GGCAGCGGAAGTTGCCCAGCTGCTAGCATAGACCCCAAGCACCGGCTCGCGTCCTTGGTTGGAGTGCCACAAAAGTGGGGCGTGTGCAAACTTCAACCGC
AACACTTCAAACGCTCAATCTACATGCACCCTTGTCGAAAGTTGTTCTCGGACAGCTCGTACAGAACAACGGCATAAACTGCGAAGTTCTCCATGAAGCA
GTTGTAATAATTCAAACTGCCCAAAAACGATTGCATGGCCTTCAGCGTCTTTGGAAATGTCACCAGTGTGTCGAGATCCTTGGGCTTCCCTTTGAGACTG
TCACCGGACACCTTGTGTCCAAGATGCTCGTCCTTCCGCATTCCCCAAAAGCTCTTCTTGACACTGATCAGCAGGTTCCAACGATTACACGCCGCGAGCT
GCACCTCGACCTTCTCGCACAACTCTCCCCATGTGCATCAACGAGGATGTCGTCGACGTACGACCACCTTCCCCCGATGACCGGCTTGCTTCCAGAGCTT
TCGGAGACTCTGGTCTCAGACACGTCATCCACCTCGTTTCCTGGCGGGCCGGTTCAGAAGATACGTACAATCCGTTGTCGATCAAGCGCTGGTAAATCT