Description :
From Genome Similarity Track
Location :
Scaffold_4445:2- 1147
Sequence
1145 bases(100 bases per row)
CGAGCGGAACTACCCTGTCCATGAACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCGCCTTCTGGGCTCTAGGCCCTTTGTGAA
CTACACAGAACACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCGAAGGATGGTGAGGTGGCTGTCCCTTCTTCGCGGAATACAACTTCCG
CGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGTGCCCCGACTATGCGTTGGCCCACATCACGCGGGTGACAACGGATCTA
TATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTCTCGTCAAGCTCCTTAAGGCGGAACGAGCGCGAAGTCCGACTGGCTCTCGCC
GCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGAC
GAGGATCTGAAGTTCGACATCCTGGCGAAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCT
GGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAG
CCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTTGGTGTTCGT
GTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCAC
GGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCA
CTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTC
GACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGGT