Description :
From Genome Similarity Track
Location :
Scaffold_4021:2- 1141
Transcript NameFunction/comments
Phypl_g16133pol protein

Sequence
1139 bases(100 bases per row)
TATCGGGAGGCTCAGCCGTACGCTTACTCCCAGCCGTATTAGTATGGCTCGTACGGGGGCTCGGCGCACGCGGCTCCAGCGTATGCACCACGGCCTTACG
GCCAGCGGGGTTATCCGACCGCTCATCAGGGGCAACCTGTGCCTGAGACTTAGTCTTGGTACGAGGAGGTGGTCAGTTCACCTCCTGGTGGCTACCCGCC
GGTTCCTGCTGGGGCAGCCTGCCCCTGCGGGTCGTGGTACCGCTTCAGACGACCCACATAAAACGTCGGGTGGGTCGTCATCGACTTAGGCAAGTCGATC
GTGTAGGCAGCTCCGTGCCTACTCAGGACCGCGAAGGGTCCAATGAAcctgtgcttcagcttgttgctgccgacAGCACTAACAGTGTTCATGGGTAGGT
TCCTCGTATCTAGGAGTACTAAGCCCCTCCCCCCACATTAAACACGTTTAAGTTTCCTCTTCCACTTCGGTCAGAGTACTCCTTTTGCCTGTCCTGGGCC
ATCGCGTCTCTAACCCGGCTGATGACATTCAGCCTGTCGTTCACAAACGACGTCAATTGCTTGCGCAATGCGGCCGGTCTCACCTCAGAGACCTGGGAGG
AAAGCGCCTCCCCCACTTACGACCGAAGCCTCGGTGTCCCCACGTAAAGTGAGCGGCACCAGGGGATGACGCATCCCATTCAAGTAGAACGGGGTGTATC
CCGTTGACGCATGCACCGCGTTGTTGAGTGCAAACTCAACCATGGACAGCCGTGCTGCCCACGTGCTCGGCGCCTCAGCACAGACACTGCGCAGCGTGTC
TTCAAGGACGCGGTTAACGCGCTCCGTCTGACCGTCCGTCTGTGGATGGTCAGCAGTTGACATGAGCAACTTCGTTCCCAGTAGCTGGAACAGCGTTTTC
CAAAACGCAGCGGTAAACCGCGGGTCTCGATCAGAGACAATGGTCTCCGGAAGACCGCGATAGCGGAACACGCAATCCAGGAACAGCCTCGCGGCTTGTT
CCCCGGTGACCGTATCGGGAACCGGAGCAAGATGCACCATCTTGCTCAGGCGGCACACAAACACCAAAATACCGGTGTTGCCGCGGTCGTCGGCTGGAAA
GCCAAAGACAAAGTCGAGGCTCATCGACTTCCAGCACTC