Description :
From Genome Similarity Track
Location :
Scaffold_364:2- 1127
Sequence
1125 bases(100 bases per row)
AACCATTCGTCGTCTATACGGATCATGCGTCATAACGCACGGCGACACAGTTGTCTCACCTCTCTCAGAGAAGAGCTCGGTGGCTTTACTTCTTTGCGGT
ATATAGCTTCGAGGTGAAGTGTAAGCCAGGCAAATGTGTTGGCAGTTGCCCTCTCTCGCAGACCTGATTATGATCTTGCTCATGTCACGAATTTGTCGTA
TCCTATTGAGGAGTTAATTCGTGCGGCATATCCACAGGGTTCTCAGTGTGTGGCATTATTTCATGCCCTTGGGAGTTCGGAATACAAGGACTCGGATAGT
CAATAATCAGCACGCATGCGGGCCAGCCTACATCGATAACCATCGACAATGGTCTTTTGTGCTATCGCACAGATTTAGCGGATACTGCTCGCATTGTTGT
GCCTCATAATGAGGATTTAAAGTATCAAATCCTCTTTGAGGCCCACGATAATTCCTTCAGTGGGCATTTGGGCCGGGAAAAGACAACACTACTGGTAGCC
CAAACTCTACAAATGGGTGAGCACATACGTGCGTACATGCAAAAACGTGCCAGTGGGTCAAACCCTAAGCACATTCGTCTGCACCACTCACCAGTTTATC
TGTGCCCCCGGGGTGTTGGGAGTCCATCAGTATGGATTTTTTGTTTGGTCTTCCCAAAGACTGTGACGGCAATACGATGATTGTAGTCTTTGTTGACCGT
TTAAGCTCGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGCCAAAGGTACAGCATGCTGTTTATCGACCGTGTGTTTCGTCAACACGGGCTGCA
CTGGTAATCATGTCTGATCGCAACCCTCGCTTCACAGGCAAGTTTTGGACATCCATCTTTAAGGTGCTTGGCACGCGATTAGATATGTCCACAGCAAATC
ATCCGCAGACCGATGGTCAGCCTGAGTAATTTAATCGCGTCATTGGCGATGTTCTTCGCAGTGTTTGTGCTGATTCACCTAAGACTTGGGGCTCGATGCT
CCCTGTCATTGAGATTGTGTTGAGAACGCTGTTCATGCCTCGACCGGCTTTACTCCCTTCTATGTGAATAGCCTCACGTTCCGCTCACGTTACCACTACG
TGGTTCTGGGCTTGGTGGGGGAGAG