Description :
From Genome Similarity Track
Location :
Scaffold_1252:2- 1114
Transcript NameFunction/comments
Phyci_358230conserved hypothetical protein

Sequence
1112 bases(100 bases per row)
CGCAATGGTTGCGTCCTCCAATGAAAACTGGTGTCATCTACAACTGGGTACACGAGATTGAGGTAACTTTTGGTCCGGGCCGACTGGGACTCAACCTCAA
GCAAATTGCAGGAATTCCTGGAACGGTATTCACGGATCTCCAGGTTCATATCGCTGAGATTTACAAGTTACCGAATGGAATGGCTAGCCCTGCAGAGATT
TATAACTGGAGTGTCAAGCCTGAGAAGCGTCTTGCAGTGAATATGCGCGTGACAATGATGAATGGGATTTCATTGTCAGGATACACATACTCGGAAGTGC
TGGAACTACTAGCTAGGATGGTACGTCCTGTTCGGATTAAGTTCGCGGATATCTCCAAGGGCATCGTTGGCCGAGTCGAAGAAGAAATTCCGCACGAAGA
GACAGAAGAAGGAAAGGAGGCCCGTGCAGCGAGGGTGATGCAAAACTCGCGTCGAGTGGAATATTTCCAAATCTTGGTGTCCTACGAGCTTCACAAGCAA
GTGTGGGCATCTACAAAACAGCACACGCGCCTGAAGCGGCTTGGGATGGAAAAGAAATGTGAGGTCATGGAATCGCAAATTGAAGGGGAGGAACAGCATA
AGGAAACTCTGGAGAAGGAACGTGAGCACTTGATTCAAGAGACGGCTTCACTGAAGGAAATGATCGAGACGTTAGACAAGCAAACGGCTGGAAATTTTGA
GTCACCAGAGGCCTTGAGGACCGCGGAGCTGACGCAACGAACCGCGGAGCTAGAGAAGGAAGTGACCGAAATCATCGCCGAAAACGAGGAACTGCAGGCT
GCACGCGTTAAAATCGAGGAGACACTCGATACGTTGCAGAAGGAGCTGGATGAATACGGAGACCTCGAAGTGGATACAAACGGCCTTGGCGAGATTAAGT
TTTTCTCGCCGGCATTTTTGGGATCGATGGTGCAGCGAGGTTCCATTGATACCCGCGCTGAGGATGCACGCGAGCGACTTCTTGAGAAGATTAAAGCTCA
ACGAGATCACCTGGAAGAAGATATTAAGTTGGAGGAGGAGCGAACGATGTTCGTGGAATCAGAGATCCATCAGTTTCAACAGCAAATGGACGTGGCCGCA
GCGGCTGTCAAG