Description :
From Genome Similarity Track
Location :
Scaffold_939:2- 1102
Sequence
1100 bases(100 bases per row)
GATGCGGACGACGACAGTCAAGACGTCGCTTCAGGGGACCGTCCGCCTCTGATACAACGAGCGACGAGGGCATCAAGCGCGAAATGCCCGAGTTGGGATT
CGGTGCCGAACGTCTCGTGGGAAACCTTTCCACTCGACTAGGGGCAATCGAAGAAATGTGAAACCCGTCTGCAAATGGTGCAAGTTGCAGATGCGGTCTA
AGGCTATTGCACCAAAGAGATGATCCGCCGACTCAGCGAAGACAGCAGGCTGGGTCGAGTCGAAGAATGATACTGCGTCAACTGTATGGATGATATGAAT
TACATGATATCGAAATGGAGTGAGCGAAGATAGAGCTGGAAAGGAAGAAGCCCATTTGCCGGGTTAGCGTTGGAGTCGGTGCGGCCGCCACAGCCACCAG
GTTGGTGGAATCCGCATCTCGGATCGAAGTCTCAGCCGAGTTGCCGAGCTGAGCGATTACGCCCAGATGGTCTGACGACGACCCTGTGAAGAAGCTGAGG
GAGGTGTGATATCGGGAAATGACCGAGAACGGCCCGCGCCGAGGCCTAACGGTCCTTCGAGTGACGGCCATCCGAGCACTCTGATTGGTTACTCTCATTC
CCCGCACTAGAGTGACAGATGGATAGCCATTTAGTGACCAGGCACGGCGGGTCATAATAAATCCCCGCCGATACCTCCAGGTAGTCATAGTGGGTACAAG
ATTTGCCTCTCATTAGGAATTCGGACCTAGCCGAGGAGTCGTCGAGTCGTCGGTCCGGCTCGAAGGCTCGGTTGATACTTGATATTTGTAAAGACATTAG
GGATTAGTTAAAGGGAAGGCCTCACAACCTCTAATCACTAAATCAGAGCAGAATTTCCCCCCGAAGCCACACAAGGGTCAAGTCCGTCTACCGGTAAGTC
TTAGCTTAGCTGTAGAGTCTGGATACGCTCGGCCGACGCGGGGTATGTCTGCTGGTGAGCATAAGGTACATTGACCGAGTGTTCATCCCTGGAAAGGCCA
AGAGTGAGTAGTGGCCGAGTGTTTGAGGTATTAGAGACCTCCCTGTACAGTTGTACGTTTGTCTGGGTGTGTGGCGTGGCCCCCCCCAGTATATTTGACT